Datasets:

---

jxm

/

nomic_embed_supervised

like 2

[ "A Python module and package loading confusion", "How do different difficulties work on story missions? When selecting a story mission, I can choose between \"Easy\" and \"Hard\". Next to the difficulty, the game displays some kind of level. However, when you start the mission, you still end up in the common map area with other players. What exactly changes when you select a higher difficulty? Is it possible to see other players playing on \"Easy\" when you select \"Hard\" before entering the mission zone where respawning is restricted?", "Search among posts you've voted for Related posts: These posts are different from mine in that they merely ask for the "votes" tab back or ask if it is at all possible to get such information, while I propose how to implement this as a search feature. Background I recently found myself facing a problem very similar to one that I had solved before. I remembered that I found the solution on SO and I remembered upvoting the post containing the solution. I wasn't able to find that particular post by just searching with relevant keywords. It would have been nice if I could search only among the questions I have voted on. I searched on meta and found that there had been a tab for looking at what you've voted on, but that it was removed due to lack of interest. This is understandable, since just listing the hundreds/thousands of posts you've voted on isn't particularly useful. Proposal What I want is to be able to search for posts I've voted on similarly to the way I'm able to search on my posts within a specific tag. For instance: user:310121 [iphone] apple This will return all my posts tagged iPhone, where I mention Apple. This is brilliant. This is just how I want search to work. Now what I want to do is to extend this to include votes. The exact syntax isn't relevant, but I had to make one up to show you what I mean: To show all posts you've voted on: user:310121 {votes} To show all posts you've upvoted: user:310121 {upvotes} To show all posts you've downvoted: user:310121 {downvotes} You could probably omit the the user part, since you're only allowed to see your own votes. (Unless it's desirable to be able to look at other peoples votes. Maybe you should be allowed to do this if you have enough rep? Well, that's another discussion.) I guess that even if you're allowed to see other peoples votes it would make sense to display your own votes if the user part is omitted. So in my case I could have done the following search and found the post I was looking for: {upvotes} keyword Lastly I just want to suggest that clicking on your vote count will work just like clicking on a tag. If I click on a tag in my profile the following search will be done: user:310121 [tag] So if I click on my upvote count the following search should be made: user:310121 {upvotes} The same goes for downvotes: user:310121 {downvotes} This would be a very useful feature and it wouldn't be intrusive in any way. The users that don't care for this feature might never know that it's there. And just for the record the favorite system doesn't replace this feature.", "What is error code 495 on Google Play and the YouTube app? \"Facebook\" could not be downloaded due to an error. (495) How do I solve this error?", "Denote by $M_{n \\times n}(k)$ the ring of $n$ by $n$ matrices with coefficients in the field $k$. Then why does this ring not contain any two-sided ideal? Thanks for any clarification, and this is an exercise from the notes of Commutative Algebra by Pete L Clark, of which I thought as simple but I cannot figure it out now.", "Rigor in quantum field theory", "Kolmogorov-Smirnov two-sample $p$-values I am using the Kolmogorov–Smirnov two-sample test to compare distributions, and I noticed a $p$-value is frequently reported as the test statistic. How is this $p$-value determined? I know it's the probability of obtaining a result at least as large as the one obtained, but how is this $p$-value determined given this is a nonparametric test? That is, we can't assume Gaussian fluctuations in the distribution and compute the $p$-value using a $t$-test. Thanks!", "See all shared items in Google Drive In Dropbox there is a place you can see all the shared items in your account (i.e., all the items you have granted others access to). Is there a similar feature in Google Drive? I'm not only trying to find items that are shared with other \"named people\", but also documents that are shared on a \"anyone with link can view / edit\" or \"public on the internet\" basis. Franck's seemed to work back in 2013, but Google Drive's interface has changed quite a bit since, and I'm struggling to be able to perform the same task with the new interface. I wonder if anyone knows how to do it in the new interface.", "Parse a Json Array in to a class in c#", "Running out of cards in Exploding Kittens In the Exploding Kittens game, the rules say You won't ever run out of cards in the Draw Pile, so there is never any need for a reshuffle. In every game I've played all the cards end up on the discard pile fairly quickly and there is nothing left in the draw pile, so we have to reuse them. Is this meant to happen? Are we doing something wrong?", "Using Squeeze Theorem to show the following limits Consider a function f (x) defined on R satisfying: for all x distinct 0. Calculate: lim f(x) with x→∞ and limf(x) with x→−∞ Issue information: if x → ∞ then we can consider | x | = x if x → -∞ then we can consider | x | = -x I can use x² = | x |?", "Is there a such thing as an exchange program in Harry Potter? In the Harry Potter universe, is there any mention of an exchange student at Hogwarts or one of the Hogwarts students going on exchange at another school? This happens all the time in the \"muggle\" school systems I'm sure it would happen in the wizarding schools as well.", "Word that describes being \"patriotic\" for something that is not a country? I'm looking for a word that is similar to patriotic but does not relate to one's country (or state). For what it's worth, I'm specifically referring to \"overly patriotic\" in a negative sense, to describe someone who has a overly sentimental/cultural or otherwise less-than-rational attachment or devotion to something and makes it part of their very identity. A common example might be an extremely zealous football fan.", "I've been doing some practice questions in the textbook for an upcoming predicate calculus lecture and I think I've managed to get A and B (possibly C) correct but I am clueless on how I can manage D and E. For A I got: ∃x(R(x)∧¬B) For B I got: ∀x(¬R(x)∧B) For C I got: ∃x(R(x)∧(x=y)) - Not sure if this is even remotely correct R(X) : ”X is rich” X = Y : ”X equals Y” B : ”Bill Gates” a) Someone besides Bill Gates is rich. b) Bill Gates alone is rich. c) At least two people are rich. d) Exactly one person is rich. e) Exactly two persons are rich. The universe of discourse is the set of all people.", "How do camera body motors compare to in-lens motors for focusing? What is the difference between using a motor on the camera body and the motor built into lenses? Aside from how both compare in terms of speed, what differences would I notice if I use a body with a motor and motor-less lens, and a lens with motor on a body that lacked one? A comparison chart outlining the various lens motor types would be a great help as high end USM motors for Sigma lenses are faster then their regular versions.", "I created a test MVC sharepoint app succesfully in a solution. Now I need to integrate this into a main solution project. But when I added a SharePoint MVC App into the solution and hit F5, I am getting following error: Error occurred in deployment step 'Install app for SharePoint': Failed to install app for SharePoint. Please see the output window for details. Detailed stack trace: CorrelationId: 50583239-71cb-4b07-8bcb-4bbc51a22631 ErrorDetail: There was a problem with activating the app web definition. ErrorType: App ErrorTypeName: App Related ExceptionMessage: Microsoft.SharePoint.SPException: Exception from HRESULT: 0x81070964 ---> System.Runtime.InteropServices.COMException: Exception from HRESULT: 0x81070964 at Microsoft.SharePoint.Library.SPRequestInternalClass.EnableModuleFromXml(String bstrSetupDirectory, String bstrFeatureDirectory, String bstrUrl, String bstrXML, Boolean fForceUnghost, ISPEnableModuleCallback pModuleContext) at Microsoft.SharePoint.Library.SPRequest.EnableModuleFromXml(String bstrSetupDirectory, String bstrFeatureDirectory, String bstrUrl, String bstrXML, Boolean fForceUnghost, ISPEnableModuleCallback pModuleContext) --- End of inner exception stack trace --- at Microsoft.SharePoint.Administration.SPElementDefinitionCollection.ProvisionModules(SPFeaturePropertyCollection props, SPSite site, SPWeb web, SPFeatureActivateFlags activateFlags, Boolean fForce) at Microsoft.SharePoint.Administration.SPElementDefinitionCollection.ProvisionElements(SPFeaturePropertyCollection props, SPWebApplication webapp, SPSite site, SPWeb web, SPFeatureActivateFlags activateFlags, Boolean fForce) at Microsoft.SharePoint.SPFeature.Activate(SPSite siteParent, SPWeb webParent, SPFeaturePropertyCollection props, SPFeatureActivateFlags activateFlags, Boolean fForce) at Microsoft.SharePoint.SPFeatureCollection.AddInternal(SPFeatureDefinition featdef, Version version, SPFeaturePropertyCollection properties, SPFeatureActivateFlags activateFlags, Boolean force, Boolean fMarkOnly) at Microsoft.SharePoint.SPFeatureCollection.AddInternalWithName(Guid featureId, Int32 compatibilityLevel, String featureName, Version version, SPFeaturePropertyCollection properties, SPFeatureActivateFlags activateFlags, Boolean force, Boolean fMarkOnly, SPFeatureDefinitionScope featdefScope) at Microsoft.SharePoint.SPFeatureCollection.AddInternal(Guid featureId, Version version, SPFeaturePropertyCollection properties, Boolean force, Boolean fMarkOnly, SPFeatureDefinitionScope featdefScope) at Microsoft.SharePoint.SPFeatureCollection.Add(Guid featureId, Boolean force, SPFeatureDefinitionScope featdefScope) at Microsoft.SharePoint.SPUserSolutionCollection.EnsureWebFeaturesActivated(SPUserSolution solution) at Microsoft.SharePoint.Packaging.SPUserCodeSolutionDeploymentGroup.ActivateSolution(SPWeb web, SPUserSolution solution) at Microsoft.SharePoint.Packaging.SPUserCodeSolutionDeploymentGroup.Deploy() at Microsoft.SharePoint.Administration.SPAppTask.DeployOperation() at Microsoft.SharePoint.Lifecycle.MonitoredTaskExecution.DoTask() Source: AppWeb SourceName: App Web Deployment Can somebody shed a light on this issue? :)", "Can you run Android in a VM on PC? I came across a how-to guide for running Android 1.7 in a virtual machine (VirtualBox), but 1.7 is old. I haven't been able to find a Android 2.2 or 2.3 image anywhere, does anyone have any ideas on how to virtualize newer Android OS's? Preferably a free virtualization solution like VirtualBox. Here is the link about virtualizing 1.7: They send you to here to download Android disk images: But I can't find anything newer than 1.7, anyone have any ideas?", "Today I was informed by VFS that my tourist visa for UAE got approved. I'm travelling to UAE on 16th December 2014 and returning on 7th Jan 2015. But when I checked the \"valid until\" date on the visa it states 30 December 2014. Does this date mean I should return before December 30th? Should I get it corrected from VFS?", "I would like to see my review audit history Confession: I have been suspended a couple times from reviewing activities. Partial Redemption: I have become better and better at passing audits. I'd like to see my recent and distant history with audits. Even better, I'd like to see my history with the various types of audits. I'm not sure this has much value beyond self-reflection and self-analysis. I'd like to see if there are patterns to when I was more likely to fail (do I get sloppy after 10 or 20?), or if there are certain types of reviews at which I struggle more (e.g., suggested edit vs close question). I suspect that if I reviewed my history and revisited audits I failed, I could create rules and rhythms for myself to become a better reviewer.", "Biblatex: Don't show n.d. when no year is given" ]

[ "Advantages of ROC curves", "When are \"if\" and \"whether\" equivalent?", "How to take the gradient of the quadratic form? It's stated that the gradient of: $$\\frac{1}{2}x^TAx - b^Tx +c$$ is $$\\frac{1}{2}A^Tx + \\frac{1}{2}Ax - b$$ How do you grind out this equation? Or specifically, how do you get from $x^TAx$ to $A^Tx + Ax$?", "How to access java-classes in the default-package? I'm working now together with others in a grails project. I have to write some Java-classes. But I need access to an searchable object created with groovy. It seems, that this object has to be placed in the default-package. My question is: Is there a way to access this object in the default-package from a Java-class in a named package?", "I have the following code for a Figure with 4 subfigures: \\documentclass{article} \\usepackage{graphicx} \\usepackage{caption} \\usepackage{subcaption} \\begin{document} \\begin{figure}[b] \\centering \\begin{subfigure}[b]{\\textwidth} \\includegraphics[width=\\textwidth]{./plots/arm1.pdf} \\subcaption{$Q^{*}$ values for arm 1} \\label{fig:arm1} \\end{subfigure} ~ \\begin{subfigure}[b]{\\textwidth} \\includegraphics[width=\\textwidth]{./plots/arm2.pdf} \\subcaption{$Q^{*}$ values for arm 2} \\label{fig:arm2} \\end{subfigure} ~ \\begin{subfigure}[b]{\\textwidth} \\includegraphics[width=\\textwidth]{./plots/arm3.pdf} \\subcaption{$Q^{*}$ values for arm 3} \\label{fig:arm3} \\end{subfigure} ~ \\begin{subfigure}[b]{\\textwidth} \\includegraphics[width=\\textwidth]{./plots/arm4.pdf} \\subcaption{$Q^{*}$ values for arm 4} \\label{fig:arm4} \\end{subfigure} \\caption{$Q^{*}$ values for different arms} \\label{fig:arms} \\end{figure} \\end{document} This results in But this way, the 4 subfigures are too large to fit on 1 page. I would like to split this over 2 pages, keeping the subcaptions a, b, ... How can I do this?", "When are stopovers permitted on Japan Railways (JR) trains? Regarding : in general, what are the rules governing stopovers for JR trains if one does not use a rail pass? A stopover means you have a ticket from stations A to B (say, Tokyo to Hiroshima) and you disembark and exit the ticket gates at an intermediate station (say, Kyoto). (Spoiler alert: it's complicated.)", "Why are Flash applications so sluggish/crashy? I've noticed that Flash applications tend to be more sluggish under Ubuntu than they do under Windows on the same machine. This is particularly noticeable when watching HD video or playing graphics/physics-heavy games. Are there any ways of improving the performance of Flash under Ubuntu, or is this just an issue with the Linux version that I will have to live with? Currently I'm just cutting down on the number of tabs open, blocking flash ads, and closing other programs, but I'm looking for ways to affect Flash itself. Other things I have already been doing include using Youtube's HTML5 feature and playing videos straight from /tmp in VLC. I was wondering if there was some way of streamlining Flash itself though. Perhaps not. More Specific Question: Is there anything I can do in mms.cfg to boost performance?", "Any way to open windows from the windows bar using a shortcut? for example to open the first window on the left Ctrl+1, to open the second window on the left Ctrl+2. Im using xfce4 at this moment, but if under xfce4 is not possible, is there any other desktop environment that permits this? Since I have several windows open for the same application, I not searching for sortcuts related to the application but as I say below, to the window.", "Schrödinger Equation for Two Electrons? I'm having trouble finding a simple answer to this question (maybe because there isn't one), but I'm just confused about how the Schrödinger Equation would look for two electrons. I understand that it would exist in 6 dimensional configuration space, but how does the potential look? It's confusing that the potential would be different for each electron depending on where the other one is.", "How to implement \"confirmation\" dialog in Jquery UI dialog?", "This is problem 31b) from Dummit and Foote chapter 14.2. I am looking for a hint on how to attack the problem, since I have been thinking about it for a couple of hours but I don't even know where to start. The problem says: Let $K$ be a finite extension of $F$ of degree $n$. Let $\\alpha$ be an element of $K$. Prove that the minimal polynomial for $\\alpha$ over $F$ is the same as the minimal polynomial for the linear transformation $T_{\\alpha}$. In this problem, $T_{\\alpha}$ is an $F$-linear transformation of $K$ that arises from $\\alpha$ acting by left multiplication on $K$. I appreciate any helpful suggestions on how to start attacking the problem or any possible hint. Thanks!", "How to display special German characters \"ÄÜÖß\" in a map?", "Interpreting Granger causality test's results I'm trying to educate myself on Granger Causality. I've read the posts on this site and several good articles online. I also came across a very helpful tool, the , that allows you to enter your time series and calculate the Granger Stats. Below, is the output from the sample data included on the site. I have also taken a crack at interpreting the results. My Questions: Is my interpretation directionally correct? What key insights have I overlooked? Also what is the meaning and interpretation of the CCF charts? (I'm assuming CCF is cross correlation.) Here are the results and plots that I have interpreted: Summary of computational transaction Raw Input view raw input (R code) Raw Output view raw output of R engine Computing time 2 seconds R Server 'Herman Ole Andreas Wold' @ wold.wessa.net Granger Causality Test: Y = f(X) Model Res.DF Diff. DF F p-value Complete model 356 Reduced model 357 -1 17.9144959720894 2.94360540545316e-05 Granger Causality Test: X = f(Y) Model Res.DF Diff. DF F p-value Complete model 356 Reduced model 357 -1 0.0929541667364279 0.760632773377753 My interpretation: Test was based upon 357 data points and was performed with a lag value of 1 The p-value of 0.0000294 means I can reject the null hypothesis that x does not cause y for the Y = f(x). The p-value of .76 allows me to accept the null for X = f(Y) The fact that first hypothesis was rejected and second accepted is a good thing I'm a little rusty on my F-test so I don't really have anything to say on this for now. I'm also not sure how to interpret the CCF graph. I really appreciate it if any of you who are well versed with Granger-causality could let me know if I'm interpeting this correctly and also fill in some of the blanks. Thanks for your help.", "Can I see images and watch movies inside the terminal emulator", "What is color temperature and how does it affect my photography?", "Regular Expression Uppercase Replacement in C# I have the following C# which simply replaces parts of the input string that look like EQUIP:19d005 into URLs, like this: input = Regex.Replace(input, @\"(EQUIP:)(\\S+)\", @\"<a title=\"\"View equipment item $2\"\" href=\"\"/EquipmentDisplay.asp?eqnum=$2\"\">$1$2</a>\", RegexOptions.IgnoreCase); The HTML ends up looking like this. <a title=\"View equipment item 19d005\" href=\"/EquipmentDisplay.asp?eqnum=19d005\">EQUIP:19d005</a> The only trouble is that the destination page expects the eqnum querystring to be all UPPERCASE so it returns the correct equipment when eqnum=19D005 but fails if it receives eqnum=19d005. I guess I can modify and correct EquipmentDisplay.asp's errant requirement of uppercase values however, if possible I'd like to make the C# code comply with the existing classic ASP page by uppercasing the $2 in the Regex.Replace statement above. Ideally, I'd like the HTML returned to look like this: <a title=\"View equipment item 19d005\" href=\"/EquipmentDisplay.asp?eqnum=19D005\">EQUIP:19d005</a> Notice although the original string was EQUIP:19d005 (lowercase), only the eqnum= value is uppercased. Can it be done and if so, what's the tidiest way to do it?", "What's the action of banging two beers together called?", "Undergraduate/High-School-Olympiad Level Introductory Number Theory Books For Self-Learning", "Quick question: what is the compiler flag to allow g++ to spawn multiple instances of itself in order to compile large projects quicker (for example 4 source files at a time for a multi-core CPU)?", "How to get autofocus to work with D5100 and AF-P DX Nikkor I just bought Nikon 18 - 55 mm f/3.5 - 5.6G VR AF-P DX Nikkor from . When I connected it to my Nikon D5100, the autofocus didn't work. There was nothing about this from the original seller's website. Is there anything I can do short of returning?" ]

[ "According to , the only restriction on self-deleting an answer is that you can't delete an answer that's been accepted. But I've also heard of users getting in trouble for deleting (non-accepted) answers, and there's the CC-SA license to consider, so -- quite aside from what is technically possible -- my question is when it's permitted to delete your own answer. Some cases to consider: You now believe the answer is incorrect. Your answer is correct, but another answer covers the same territory better. You aren't satisfied with the quality/rigor of your answer, e.g. it's speculative and you didn't back it up (on a site that expects that). Something in the answer embarrasses you and you'd rather just make it go away. Your answer wasn't well-received by the community (whether that's \"meh\" or \"make the rep bleeding stop please\"). (I'm sure there are others; this isn't meant to be an exhaustive list.) Does voting matter, either in absolute terms or in comparison to other answers? For example, maybe it's ok to delete a lower-voted one but not the top-voted answer, or one with score > N?? There is a badge, Disciplined, for deleting your own post of score 3 or higher. This tells me that it's sometimes ok to delete upvoted answers. But I'm not sure how much policy we can infer from badges. Could we have some clarification please?", "Solve $[2^{(2^{403})}] = [a]$ in $\\mathbb Z_{23}$ where $0 \\le a < 23$. Solve $[2^{(2^{403})}] = [a]$ in $\\mathbb Z_{23}$ where $0 \\le a &lt; 23$. I've tried to combine corollaries of Fermat's little theorem and various other methods to solve this, but have always been stuck.", "Are keywords in URLs good SEO or needlessly redundant? A coworker and I are locked in a debate over the value of SEO keywords in the URL of a page. She wants to change all the filenames of the HTML pages of a fencing company so they look like residential-home-chicago.html, contact-chicago-contractor.html, and so on. She is convinced that because Google highlights keywords in URLs in search results, that means that putting keywords here is more valuable. My position is that these do not improve SEO, since Google doesn't seem to give keywords in the URL any more weight than keywords in the body of the page, and . In the meantime, they make it harder for me to find the pages I want when its time to edit them, and the site as a whole looks cheap and spammy. suggests to me that yes, keywords in URLs are useful, but not superior, and that they are more useful for human readability than search engine rankings. I'm looking for authoritative sources that support either position, not blog articles from SEO optimization companies trying to promote themselves.", "Story [novel, novella?] that featured faster-than-light or hyperdrive gained from observing distant drive use, also had a sentient star I have little recollection when I read this, but it started with people observing indications of some special engine use many lightyears away, and it led them to 'reverse-engineer' the traces to create their own drive. Had the usual tropes of international crew-selection for first-voyage. Somewhere in the travel, they encounter a sentient star or quasar. When they get back hundreds/thousands of years later, they arrive to an uncaring Earth that no longer pursues space-travel.", "Java ReentrantReadWriteLocks - how to safely acquire write lock? I am using in my code at the moment a to synchronize access over a tree-like structure. This structure is large, and read by many threads at once with occasional modifications to small parts of it - so it seems to fit the read-write idiom well. I understand that with this particular class, one cannot elevate a read lock to a write lock, so as per the Javadocs one must release the read lock before obtaining the write lock. I've used this pattern successfully in non-reentrant contexts before. What I'm finding however is that I cannot reliably acquire the write lock without blocking forever. Since the read lock is reentrant and I am actually using it as such, the simple code lock.getReadLock().unlock(); lock.getWriteLock().lock() can block if I have acquired the readlock reentrantly. Each call to unlock just reduces the hold count, and the lock is only actually released when the hold count hits zero. EDIT to clarify this, as I don't think I explained it too well initially - I am aware that there is no built-in lock escalation in this class, and that I have to simply release the read lock and obtain the write lock. My problem is/was that regardless of what other threads are doing, calling getReadLock().unlock() may not actually release this thread's hold on the lock if it acquired it reentrantly, in which case the call to getWriteLock().lock() will block forever as this thread still has a hold on the read lock and thus blocks itself. For example, this code snippet will never reach the println statement, even when run singlethreaded with no other threads accessing the lock: final ReadWriteLock lock = new ReentrantReadWriteLock(); lock.getReadLock().lock(); // In real code we would go call other methods that end up calling back and // thus locking again lock.getReadLock().lock(); // Now we do some stuff and realise we need to write so try to escalate the // lock as per the Javadocs and the above description lock.getReadLock().unlock(); // Does not actually release the lock lock.getWriteLock().lock(); // Blocks as some thread (this one!) holds read lock System.out.println(\"Will never get here\"); So I ask, is there a nice idiom to handle this situation? Specifically, when a thread that holds a read lock (possibly reentrantly) discovers that it needs to do some writing, and thus wants to \"suspend\" its own read lock in order to pick up the write lock (blocking as required on other threads to release their holds on the read lock), and then \"pick up\" its hold on the read lock in the same state afterwards? Since this ReadWriteLock implementation was specifically designed to be reentrant, surely there is some sensible way to elevate a read lock to a write lock when the locks may be acquired reentrantly? This is the critical part that means the naive approach does not work.", "How can I integrate $\\ln \\left( x+\\sqrt{1+x^2} \\right) $?", "May I use a question mark in the middle of a sentence? Examples: Would you like the drapes to be white? or perhaps something off-white? Would you like the logo to be centered? at the bottom? left off entirely?", "What does the Web.Config file do in the views folder of a MVC project", "Why is quantum entanglement considered to be an active link between particles?", "How can I require an optional Perl module if installed? I have Perl code which relies on Term::ReadKey to get the terminal width. My installation is missing this module, so I want to provide a default if the module isn't present rather than throw an exception. How can I conditionally use an optional module, without knowing ahead of time whether it is available. # but only if the module is installed and exists use Term::ReadKey; ... How can I accomplish this?", "Calculating $\\lim_{x\\to0} \\left\\lfloor\\frac{x^2}{\\sin x \\tan x}\\right\\rfloor$ Find $$\\lim_{x\\to0} \\left\\lfloor\\frac{x^2}{\\sin x \\tan x}\\right\\rfloor$$ where $\\lfloor\\cdot\\rfloor$ is greatest integer function I am a high school teacher. One of my students came up to ask this limit. For $\\lfloor\\frac{\\sin x}{x}\\rfloor$, I have used $\\sin x &gt; x$ using increasing decreasing functions. I tried to prove $x^2 &gt; \\sin x \\tan x$ using increasing /decreasing function but I am not getting it.", "Find the limit: $\\lim_\\limits{x\\to 0}{\\frac{\\left(1+x\\right)^{1/x}-e}{x}}$ Find the limit: $$\\lim_\\limits{x\\to 0}{\\frac{\\left(1+x\\right)^{1/x}-e}{x}}$$ I have no idea what to do, but I thought that this is the limit of the derivative of $f(x)=\\left(1+x\\right)^{1/x}$, as $x$ tends to 0. Any help?", "problems installing mathtools", "What are the uses of \"using\" in C#? User answered the wonderful question by mentioning the using keyword. Can you elaborate on that? What are the uses of using?", "How can I distribute a native executable for a Python program?", "Ubuntu 19.10 change desktop environment", "Precision of Coulomb's law Up to which precision has the coulomb law proven to be true? I.e. if you have two electrons in a vacuum chamber, 5 meters appart, have the third order terms been ruled out? Are there any theoretical limits to measure the precision ( Planck's constant?). Obviously there are practical limitations ( imperfect vacuum, cosmic rays, vacuum fluctuation). Still, does anyone know what was the smallest amount ever correctly predicted by that law? Edit : Summary On the high end of the energy spectrum a precision of 10^-16 has been shown ( 42 years ago ) For electron point charges at large distances the law might brake down due to practical reasons. For moving particles QED gives a correction to the law:", "Determining functions from specifications... my high school teacher asked this question today, and I am struggling to find an answer that will work. The question is outlined below: Give an example of a cubic polynomial, defined on the open interval (-3,3), which reaches both its maximum and minimum values.", "View a man page in a specific section I wanted to access man pages for command chmod. Command whatis chmod gave this output: chmod (2) - change permissions of a file chmod (1) - change file mode bits But I was actually looking for chmod(2). When I type man chmod, man pages for chmod(1) appears. Both man chmod(2) and man 'chmod(2)' commands show error. I tried running info coreutils 'chmod invocation', but output is some kind of documentation which doesn't look like a typical man page.", "More numbers between $[0,1]$ or $[1,\\infty)$?" ]

[ "How do you read CSS rule values with JavaScript?", "How does \"this\" keyword work within a function? I just came across an interesting situation in JavaScript. I have a class with a method that defines several objects using object-literal notation. Inside those objects, the this pointer is being used. From the behavior of the program, I have deduced that the this pointer is referring to the class on which the method was invoked, and not the object being created by the literal. This seems arbitrary, though it is the way I would expect it to work. Is this defined behavior? Is it cross-browser safe? Is there any reasoning underlying why it is the way it is beyond \"the spec says so\" (for instance, is it a consequence of some broader design decision/philosophy)? Pared-down code example: // inside class definition, itself an object literal, we have this function: onRender: function() { this.menuItems = this.menuItems.concat([ { text: 'Group by Module', rptletdiv: this }, { text: 'Group by Status', rptletdiv: this }]); // etc }", "system of ode with non-constant coefficient matrix", "Do you get to use the additional attack from the Extra Attack feature as well when you Ready an Attack action? One of my players, a monk, decided to Ready an action as an earth elemental was about to attack. The trigger was the elemental moving within five feet of him. When this occurred, he took his Attack action, and then proceeded to take the extra attack as well. I was unsure at the time whether or not the extra attack would also happen, and I haven't had much luck figuring it out.", "I am having a lot of trouble with these series questions. Up until this point, I had relatively little trouble with all the questions in the book. These seem to require knowledge about approximations of functions and other external experience-based knowledge, which I just don't have yet. Determine convergence or divergence of the given series. In the case of convergence, determine whether the series converges absolutely or conditionally. $$\\sum_{n=1}^\\infty (-1)^n\\left[e-\\left(1+\\frac 1 n \\right)^n\\right]$$ It's easy to see that $$\\lim_{n\\to\\infty}\\left[e-\\left(1+\\frac 1 n\\right)^n\\right]=0$$ however, in order to apply Leibniz's Rule and show conditional convergence I need to show that the sequence is monotonically decreasing. This doesn't seem doable with straight inequalities, so I tried taking the derivative, which just resulted in an uninterpretable mess. This doesn't even begin to address the question of absolute convergence/divergence. There are 54 of these questions... I must be missing something really fundamental if they all take this long.", "Need to prove that $(S,\\cdot)$ defined by the binary operation $a\\cdot b = a+b+ab$ is an abelian group on $S = \\Bbb R \\setminus \\{-1\\}$. So basically this proof centers around proving that (S,*) is a group, as it's quite easy to see that it's abelian as both addition and multiplication are commutative. My issue is finding an identity element, other than 0. Because if 0 is the identity element, then this group won't have inverses. The set explicitly excludes -1, which I found to be its identity element, which makes going about proving that this is a group mighty difficult.", "Does an unpublished document you upload to ResearchGate count as prior publication when submitting to a journal? On ResearchGate, if you upload something like a thesis, and then it says publish resources, does this mean the thesis becomes properly published in the sense of the usual requirements of journals that there be no prior publication of the submitted work? I ask because I’m drafting thesis chapters into journal articles and did not choose to publish the thesis as a whole work in order to do so, so I want to make sure that by clicking publish resources I am not actually publishing the copy I’ve uploaded, I’m just making it publicly available? Does this mean it becomes published despite it not technically being a published work? (If so, I’ll just remove the copy I uploaded).", "Why is every Noetherian zero-dimensional scheme finite discrete?", "OEM license activation for Windows 10 Home VirtualBox guest, on Ubuntu host Context Three years ago my company got me a Lenovo T550 with Windows 10 Home installed on it (my understanding is that this is called &quot;OEM&quot;). I immediately erased everything to install Ubuntu on it. Unfortunately from now on I will need to use Windows 10 a few times a week for legacy reasons, but my main work is still on Ubuntu, so I am thinking of running Windows 10 within VirtualBox within Ubuntu. Lenovo recommendation Lenovo told me that my Windows Home license is somehow linked to my hardware (firmware?) and that Windows will automatically find this out. They pointed me to : The installation of Microsoft Windows Server 2008,2008 R2 SP1, 2012, and 2012 R2 from Lenovo OEM media to such a virtual machine will fail until the virtual BIOS has been updated to include this information. setVMBIOS.exe performs this function for servers using Microsoft Hyper-V technology. Consult your hypervisor vendor for information on how to perform this function on other hypervisors. [...] The fix resolves this issue by adding Lenovo information to the virtual BIOS. Note: That page does not mention Windows 10 Home, but I guess the same applies? VirtualBox How to apply Lenovo's recommendation to VirtualBox? (5.2.18) Right now I have out-of-the-box VirtualBox and the VM I created yesterday with standard settings does not activate: Windows is not activated. Windows reported that no product key was found on your device. Error code: 0xC004F213", "Intuitive explanation of the bias-variance tradeoff? I am looking for an intuitive explanation of the bias-variance tradeoff, both in general and specifically in the context of linear regression.", "Setting DIV width and height in JavaScript", "When is the sum of divisors a perfect square?", "I have added a custom/secondary query to a template file/custom page template; how can I make WordPress use my custom query for pagination, instead of using the main query loop's pagination? Addendum I have modified the main loop query via . Why isn't pagination working, and how do I fix it?", "Imagine a black hole that is fast-approaching its final exponential throws of Hawking evaporation. Presumably, at all points in this end process there will remain a region that identifiably remains &quot;the black hole&quot; until the the very end, as opposed to huge swarm of fundamental particles that is being radiated out from it. As the mass of the black hole descends to that of individual particles, it would seem entirely feasible that the very last fermionic Hawking radiation event available to the almost-deceased black hole could leave it with an unbalanced charge, e.g. -1, and an unbalanced spin, say 1/2. It would also have some kind of mass of course, but that aspect of the final residue could be fine-tuned to any specific value by photon emissions of arbitrary frequencies. After photon emission mass trimming, the resulting black hole residuum would reach a point where it is no longer be able to evaporate into any known particle, because there is no longer any lower-mass option available to it for removing the -1 charge and 1/2 spin. The black hole residuum will at that point be stuck, so to speak, stuck with exact charge, spin, and mass features of an electron. And so my question: Is it an electron? And if so, by equivalence, is every electrons in the universe really just a particular type of black hole that cannot evaporate any further due to the constraints of charge and spin conservation? And if so, why are charge and spin so uniquely combined in such black hole remnants, so that e.g. a remnant of -1 charge and zero spin is not permitted, at least not commonly, and the mass is forced to a very specific associated level? Is there anything in the current understanding of general relativity that would explain such a curious set of restrictions on evaporation? The full generalization of this idea would of course be that all forms of black hole evaporation are ultimately constrained in ways that correspond exactly to the Standard Model, with free fundamental particles like electrons being the only stable end states of the evaporation process. The proton would be a fascinating example of an evaporation that remains incomplete in a more profound way, with the three quarks remaining incapable of isolated existence within spacetime. The strong force, from that perspective, would in some odd sense have to be a curious unbalanced remnant of those same deeper constraints on the overall gravitational evaporation process. This may all be tautological, too! That is, since Hawking radiation is guided by the particles possible, the constraints I just mentioned may be built-in and thus entirely trivial in nature. However, something deeper in the way they work together would seem... plausible, at least? If an electron is an unbalanced black hole, then the particles given off would also be black holes, and the overall process would be not one of just particle emission, but of how black holes split at low masses. Splitting with constraints imposed by the structure of spacetime itself would be a rather different way of looking at black hole evaporation, I suspect. (final note: This is just a passing thought that I've mulled over now and then through the years. Asking it was inspired by by Ben Crowell. I should add that I doubt very seriously that that my wild speculations above have anything to do with Wheeler's concept of geons, though.)", "How do you use a variable in a regular expression?", "Do I need to enable the publishing features to change a Team Site's master page? When building a SharePoint 2010 site, we have a root Publishing site that has been branded up using a custom Master Page. We'd now like to add some Team Sites below the publishing site, and have our branding and other look and feel changes applied there too, and for that we need to change the \"System Master\" setting of the Team Site. The \"Master page\" options in the site settings are only available if I've enabled the Publishing features in the team site, but I'd rather not do this if I can avoid it. Ideally, this should be enabled as soon as a new team site is created, without the site owner having to change the site settings.", "What to do to switch to biblatex? Because of the great answers posted around in the site, I'm finally considering to do the switch and move to biblatex. So, the question is what do I have to do? To give the question some focus, assume that I already have a somewhat largish .bib file and a bunch of documents using natbib for my references. What do I have to change in my existing .bib and .tex files? And what about coauthors? Would it be reasonably simple to instruct them how to work with the new documents using biblatex? Do they have to install new software/packages as well?", "Problem: Evaluate $$ L=\\displaystyle \\lim_{n \\to \\infty} \\frac{1}{n} \\sum_{k=1}^{n} \\left( \\left\\lfloor \\frac{2n}{k} \\right\\rfloor -2\\left\\lfloor \\frac{n}{k}\\right \\rfloor \\right).$$ Please help me with this one. I tried using the sandwich theorem by first constructing the following $$ 2 \\geq \\left\\lfloor \\frac{2n}{k} \\right\\rfloor -2\\left\\lfloor \\frac{n}{k} \\right\\rfloor \\geq -1 $$ and then summing over. But the limit of the two bounds are different so sandwich theorem doesn't help!. Is it possible to construct sharper bounds? Also I observed that if we ignore question of continuity, etc. then we can write, $L= \\displaystyle \\int ^{1}_{0}\\left\\lfloor \\frac{2}{x} \\right\\rfloor -2\\left\\lfloor \\frac{1}{x} \\right\\rfloor dx$ Now I am able to compute the above integral. But is the above process correct? If then how can make it rigorous? Or if any other approach is possible, please tell.", "My machine can't play encrypted DVDs on a fresh install. How do I add this capability? Another useful bit of information would be what programs are best for playing DVDs, once I'm able to do so. See the . Will I be able to play DVD movies from ?", "I came across a user with a notification that states: This account is temporarily suspended network-wide. The suspension period ends on Dec 2 '18 at 2:35. Screencap for posterity: Unless this user is (in which case the full year should be shown, or at least a tooltip), it seems like they should have been unbanned 4 months ago." ]

[ "How to do version numbers? My company is building a product. It's going to be versioned by SVN. It's a webapp so basically there will never be a version out which doesn't have some features in them and thus could always be labeled as beta. But since it's going to be a corporate product I really don't want the \"unstable watchout\" on there. So how would you go about versioning? Is 1.0 stable? Should the build date be in the version number? Tell me what you guys think!", "Finding the unique rock with its weight I have 12 rocks, all have the same weight except for one rock, but I don‘t know which rock is. How do I know which rock is different from other, and also know that rock heavier or lighter, with maximum 3 comparating steps. My only tool is just a balance that can only compare the weight between the rocks.", "My Ubuntu is running fsck on every bootup On every bootup it's the same: /dev/sda1: clean, 908443/38690816 files, 44176803/154733312 blocks Is it some kind of option Ubuntu uses to ensure filesystem consistency or is there something wrong with my HDD? fsck takes up to 30s while booting and so about triples the time needed otherwise. Full output (partly in German): Begin: Loading essential drivers ... done. Begin: Running /scripts/init-premount ... done. Begin: Mounting root file system ... Begin: Running /scripts/local-top ... done. Begin: Running /scripts/local-premount ... done. Begin: Running /scripts/local-bottom ... done. done. Begin: Running /scripts/init-bottom ... done. fsck von util-linux 2.20.1 /dev/sda1: sauber, 908443/38690816 Dateien, 44176803/154733312 Blöcke udevd[623]: unknown key 'SYSFS{idVendor}' in /lib/udev/rules.d/45-libticables.rules:6 udevd[623]: invalid rule '/lib/udev/rules.d/45-libticables.rules:6' * Starting mDNS/DNS-SD daemon [ OK ] * Starting Reload cups, upon starting avahi-daemon to make sure remote queues are populated [ OK ] * Starting configure network device security [ OK ] * Starting bluetooth daemon [ OK ] ####* Starting all other stuff", "$\\operatorname{Ext}$ and injectives, respectively projectives", "If I could stop ALL motion would I stop time? I've never really understood time. Time is not a force. It isn't energy or matter. Time doesn't MAKE anything do anything. Time doesn't make a clock tick (motion or batteries do). Time doesn't make the earth revolve around the sun (motion/gravity does). I don't think time exists. People say time is used as a form of measurement but aren't we just measuring movement? Even atomic clocks measure the movement of electrons that orbit an atom's nucleus as they \"jump\" back and forth between energy states. So my question is if I were to stop ALL motion (even movement of electrons that orbit an atom's nucleus) would I stop time? Is time just masquerading as the measurement of motion? EDIT: This question is not a duplicate of \"Does time freeze at Absolute Zero?\" Because I am NOT talking about temperature. I am speaking about the motion of ALL things. I am asking if ALL things (photons, energy, matter, forces) stop moving would time stand still? I would have to say yes it would. If ALL motion were to stop for a million years and then start again no one would even know. Atomic clocks wouldn't even miss a step.", "After the death of Lord Voldemort, Harry was taken to the Dursleys and became known as \"The Boy Who Lived\". We know that the Wizarding World found out that Voldemort was dead and undoubtedly it was Dumbledore that advised people that Harry had somehow survived the attack and caused Voldemort's death. According to Snape (in HP:HBP) there were even persistent rumours that Harry was a powerful Dark Wizard in the making until he turned up at Hogwarts a decade later. My question is : Where did the Wizarding World think Harry was for the intervening 10 years?", "How do you combine two jQuery search results? eg: var $allFoos = $('.foo'), $allBars = $('.bar') $allFoosAndBars = $allFoos + $allBars; Obviously, I just made up that last line, but I hope it makes it sorta clear what I mean. To be clear, the example is greatly simplified, and it could be any arbitrary sets i'm talking about, so $('.foo, .bar') is not what I'm after.", "Ellipsis in array initialization in C kernel module", "VMware won't work after Ubuntu Upgrade I upgraded to Ubuntu 15.10 and now if I want to open VMware Player it doesn't do anything. I also uninstalled and installed it again, still nothing. What can I do?", "Is it possible to earn more than 100 lollipops per second? I have pumped my lollipop rate to 100/s, but it took a long time to go from 99 to 100. Is it even possible to get higher or should I stop?", "What is a good Hash function? I saw a lot of hash function and applications in my data structures courses in college, but I mostly got that it's pretty hard to make a good hash function. As a rule of thumb to avoid collisions my professor said that: function Hash(key) return key mod PrimeNumber end (mod is the % operator in C and similar languages) with the prime number to be the size of the hash table. I get that is a somewhat good function to avoid collisions and a fast one, but how can I make a better one? Is there better hash functions for string keys against numeric keys?", "My book (Concepts of Physics by H.C. Verma) writes: It has been reported () that the force between two masses may be better represented by $$F = \\frac{G_{\\infty} m_{1} m_{2}}{r^2} \\left[1 + \\left(1 + \\frac{r}{\\lambda} \\right) \\alpha e^{-\\frac{r}{\\lambda}}\\right]$$ where $\\alpha \\approx - 0.007$ and $\\lambda \\approx 200~\\mathrm{m}$. What is this? Such a horrendous formula! So, what about Newton's? And what's the difference between $G$ &amp; $G_{\\infty}$?", "I read on the : Focal-length determines the angle-of-view seen through a lens for a given sensor-size. With a full-frame sensor a lens gives the same angle-of-view as it would on a 35mm film camera. With a smaller sensor, the angle-of-view becomes smaller. The crop-factor, also called FLM, is the ratio representing the difference in equivalent focal-lengths. So a 150mm on a full-frame DSLR such as the Nikon D700 gives the same angle-of-view as a 100mm on a D7000 since its FLM is 1.5X. Short focal-lengths show a greater angle-of-view compared to longer ones. [...] In layman's terms, what is angle-of-view? Is it the same as focal length? If not, how is it different? How is it used? Why do I need to know about it?", "Success of Bernoulli trials with different probabilities", "Floor a date in SQL server In SQL Server, how do I \"floor\" a DATETIME to the second/minute/hour/day/year? Let's say that I have a date of 2008-09-17 12:56:53.430, then the output of flooring should be: Year: 2008-01-01 00:00:00.000 Month: 2008-09-01 00:00:00.000 Day: 2008-09-17 00:00:00.000 Hour: 2008-09-17 12:00:00.000 Minute: 2008-09-17 12:56:00.000 Second: 2008-09-17 12:56:53.000", "I took a bunch of photos at my son's martial arts club using a D90 with a 50mm F1.8. The club is lit with overhead fluorescent lighting, and I was getting some weird results where some shots are \"white\", others have an \"orange cast\", and still others are partly white and partly orange in the same shot. I suspect it has to do with the combination of the frequency of the light flicker and with the camera shutter speed. Here is a sequence of 3 shots that show the problem. The shots were taken with 1/500s at F2 and ISO-800 and with Auto-WB. First shot (\"white/normal\"): Second shot (\"orange cast\" at top): Third shot (\"orange cast\" at bottom): These were taken in burst mode within a second of each other. Can anybody tell me what is going on? And, how I can avoid this?", "Some icons are correct, and some are whack. Turns out it's not just the hot questions list, but the whole icon set.", "Using Squeeze Theorem to show the following limits Consider a function f (x) defined on R satisfying: for all x distinct 0. Calculate: lim f(x) with x→∞ and limf(x) with x→−∞ Issue information: if x → ∞ then we can consider | x | = x if x → -∞ then we can consider | x | = -x I can use x² = | x |?", "What happened to these edits (and the associated reputation)? My reputation rating on SO took this hit an hour ago, and it is due to what appears to be the simultaneous deletion of multiple questions. I am uncertain why it happened, am concerned, and would appreciate an explanation. Going to shows that it was removed due to moderation. Was a script run deliberately, or were we hit with a question deletion attack; what happened? -12 today -2 1 hour ago removed How to send a 2d Vector over UDP in c++ -2 1 hour ago removed How do I use the Eclipse debugger to debug a Java application? -2 1 hour ago removed PHP string error; inconsistency with local and server -2 1 hour ago removed Unable to start the MySQL service after a server migration -2 1 hour ago removed How to use Java to print a text file on a ticket printer? -2 1 hour ago removed How can all of the ZBrush Obj files be imported to make a complete model?", "Using PTSerif-TLF for Cyrillic with TeX Gyre Pagella" ]

[ "If column matches another file, print every line with match (awk/grep) I’m taking two input files, one with certain ID numbers, and another with a large list of ID numbers and additional columns. The latter file contains multiple lines for each ID number and I need to extract all lines that match an ID from the first file. Those lines then must be printed in a new file. Edit 1: Replaced sample files with excerpts from actual Edit 2: Removed extra spaces that were in excerpt, but not actual file. Files likely need to be sanitized in some way, but how is unclear. file1: AT1G56430 AT3G55190 AT3G22880 file2: AT1G01010|GO:0043090|RCA AT1G56430|GO:0010233|IGI AT1G56430|GO:0009555|IGI AT1G56430|GO:0030418|IGI expected output AT1G56430|GO:0010233|IGI AT1G56430|GO:0009555|IGI AT1G56430|GO:0030418|IGI [[ I have tried: awk -F'|' 'NR==FNR{c[$1$2]++;next};c[$1$2] &gt; 0' file1 file2 &gt; output.txt and: grep -Ff file2 file1 &gt; output.txt I’m aware that there are many somewhat similar questions posted in these forums and others. However, these don’t mention how the output is handled… nor do they mention duplicates. I’ve tried solutions from 4 of them, have been messing with this for many hours and keep getting the same problem: a blank output file. I’m new to awk and I greatly appreciate the help. Sorry if this is a simple problem with syntax etc; please let me know. Thanks for the help.", "Driver locked memory on a non-virtual machine", "How to open and convert CHM documents? I have some documents that are in a .chm format. I wondered if there is a file format that can be easier to navigate, supported and of equal file size in Ubuntu? If there is, I would like to start converting all those books and probably using them with less hassle on all my Ubuntu PCs and my Android phone.", "JavaScript: getting ImageData without canvas", "Tweaking AStar to find closest location to unreachable destination I've implemented AStar in Java and it works ok for an area with obstacles where the chosen destination is reachable. However, when the destination is unreachable, the calculated \"path\" is in no way to the closest location (to the unreachable location) but is instead some random path. Is there a feasible way to tweak AStar into finding the path to the closest location to an unreachable destination?", "How do I wrap a macro definition in an environment? I'm creating a style file, and want to store the body text of the abstract environment so that I can put it on my custom titlepage. I could have required that my users enter the abstract as \\customabstract{Abstract text goes here}` which I would have implemented as something like \\newcommand{\\customabstract}[1]{\\gdef\\abstracttext{#1}} However, I would prefer that the user is able to use environment notation, \\begin{customabstract}Abstract text goes here\\end{customabstract} To do this, I thought I could define something like \\newenvironment{customabstract}{\\gdef\\abstracttext\\bgroup}{\\egroup} But this definition makes \\abstracttext expand to \\bgroup, which is not what I wanted. I tried to solve the problem by \\expandafter, \\newenvironment{customabstract}{\\expandafter\\gdef\\expandafter\\abstracttext\\bgroup}{\\egroup} but this results in a runaway error. Is there any way to acheive what I want? Answers that helps me understand the inner workings of TeX (instead of just referring to a custom package) are preferred.", "Why do I get more satisfaction out of participating in SO than out of my job? Alternatively, are there good ways to get more satisfaction out of my job, possibly by leveraging my participation in SO?", "What happens to the Windows 7 key when upgrading to Windows 8? Microsoft is offering \"Microsoft Windows 8 Professional Upgrade\" at a discounted price compared to the OEM version. However it states: If you currently have a personal computer running Windows 7, Windows XP or Windows Vista then you can upgrade to Windows 8 Pro (Professional). My question is what happens to the Windows 7 key that I use to upgrade? Will it become the Windows 8 key or will it generate a new Windows 8 key? Basically if I upgrade using my Windows 7 key from my laptop for my desktop will I be able to continue using the laptop on Windows 7 while concurrently using Windows 8 upgrade on my Desktop?", "What is the maximum convergent $x$ in the power tower $x^{x^{x^{x\\cdots}}}$? In the power tower $x^{x^{x^{x\\cdots}}}$ where there is an infinite stack of $x$'s, what is the maximum convergent number? I know the answer by playing with the form $x^y=y$ and using Mathematica, but I don't know how to solve this by hand.", "Force refresh view in LWC In Aura, we can do $A.get('e.force:refreshView').fire(); to cause standard components to update. How can we do an equivalent in LWC because sfdx refuses to publish .js code with $A in it saying the usage is disallowed in LWC? For now i tricked it with eval(\"$A.get('e.force:refreshView').fire();\"); but that is obviously less than ideal....", "Live USB for installation does not boot, black error screen followed by visual artifacts on a purple screen", "Global setting of spacing between items in itemize environment for beamer", "What is the purpose of the bin directory? What are some examples?", "Minecraft pocket edition restoring skin problem I updated Minecraft PE so I can have custom skins. I clicked on 'restore skins' without selecting any particular skin, It is now stuck with a message saying 'we're restoring your skins!' but it has been like that for 20 minutes. Is there a reason why it is like this?", "Some of the git commands have many options, and it would often be useful to search through them for the one I need - I was just looking for the option which controls the TAB width in git-gui, but there are about 200 completions for git config. An obvious workaround is to copy all the completions into an editor and search through them, but I'd rather do [something] | grep tab There are no man or info pages for compgen, help compgen doesn't even explain its own options, and there's no auto-complete for compgen (how's that for irony?). PS: doesn't work. PPS: This is not a question about git-gui - The was elsewhere. PPPS: This is not about auto-completing commands, only command parameters.", "Do you ever need to specify 'javascript:' in an onclick?", "Case assignment rule is always executed in the test class", "Term for words like Snowmageddon, Nipplegate and even cheeseburger?", "I have an interesting mathematical/electrical dilemma and I'm not sure where to start. I am considering buying (specs on page). I will be hopefully buying a battery pack with it to support a long-road trip (a few months) wherein I'll keep medication in the fridge (powered by the battery pack when parked and by the car when driving). The medication needs to be keep between 2 and 8 degrees C at all times. Here's the I'm thinking of getting: Can someone please help me understand what I need to do in order to calculate whether or not this fridge + battery combo will work, and if so, how much time will I be able to power the fridge for. Ideally, I need a combination of fridge and battery which will allow me to have the fridge constantly powered, assuming I sleep in the car for approx. 8 hours a night and drive for the rest of the day (although, there will be times which I'm away from the car during the day for several hours + times where I hope to have access to a wall outlet). Specs: Fridge: Input voltage (AC 220-240 V Input frequency 50/60 Hz Rated input power (AC) 64 W Rated input power (DC) 46W DC12V/50W DC24V W Input voltage (DC) 12/24 V Battery: Capacity: 453Wh Battery Type: Lithium-ion Input Voltage: AC 110-220 V, 50/60 Hz; Solar Power: 18 V; Car Input: 12 V Output Voltage: AC 110V 60 Hz; DC Output: 4 * 12V 4 A (Max.10 A); USB Output: 4 ports: 2* 5V 2.1 A and 2* 5V 1 A Power Output: Rate 500 W Peak/Surge 1000 W", "How do I re-position the displayed image on my laptop? I want to re-position the display on my ASUS K53SM laptop's screen because I somehow managed to damage some portion of it (and I don't want to spend on this laptop for the time being). Please refer the following image: I changed the resolution from 1366x768 to 1280*768 to avoid the bad portion of the screen, but the screen is now centered and the right portion of my screen is now rendered useless. What I want to do is, set a custom resolution of my laptop and re-position it in a way that is utilizes all the working area of my screen. How do I re-position the displayed image on my laptop?" ]

[ "Formatting OGR VRT file to convert CSV to KML?", "Google Chrome: Is there a keyboard shortcut to open a link in a new tab? Is is possible to open a link in a new background tab in Google Chrome with a keyboard shortcut? (I know it's possible with Ctrl+click and middle click, and I know that Shift+Enter opens the link in a new browser window.)", "Could I have a hint for testing the convergence of the following series please? $$\\sum_{n=2}^\\infty\\frac{1}{(\\ln n)^{\\ln n}}$$ I am very appreciative for your help.", "Why does Calculate button remain gray in Group Stats Plugin for QGIS? In my case I failed to use plugin (2.0.30) with QGIS 2.14.11 and 2.18.3 on windows64. Tested on several datasets: points, polygons, and csv.- But I am not sure what I have missed. I want to click on this Calculate button.", "Best practices for Feed restructuring in a social app database", "Prove that the equation $x^4+(2k^2)x^2+2k^4$ is not a perfect square", "Find the Limit (n to infinity) Hi I have a question regarding of limits to infinity please help! Thank You! The question states the user to find the following limit: $ \\lim_{n\\to\\infty} n^2 ({\\sqrt[n]{x}-\\sqrt[n+1]{x}}) $ Where $(x &gt; 0) $ Thank You!!!", "I have a dataset that has both continuous and categorical data. I am analyzing by using PCA and am wondering if it is fine to include the categorical variables as a part of the analysis. My understanding is that PCA can only be applied to continuous variables. Is that correct? If it cannot be used for categorical data, what alternatives exist for their analysis?", "Where can I start to learn ArcPy?", "How to use WiFi and Ethernet at the same time Brief Description: I need my Ethernet card (en0) to see all traffic under 192.168.2.xxx. However I also need to use WiFi card (en1) for all other traffic. OS: OS X Lion I am using a separate network location to deal with this specific use (since this is a for a robotics project that communicates via Ethernet). Ethernet (en0) had to be set up as a static IP (192.168.2.10) per the requirements for the device I am connecting to. All connections on the Ethernet card (en0) should be 192.168.2.xxx as specified above. WiFi (en1) is set up as DHCP to a router since their is no point in assigning it as a static for general purpose traffic. Ethernet (en0) is set up as priority over WiFi (en1). I would also like to keep this under the network location preferences if at all possible since I do not require this feature to be on all the time. I would really appreciate your help on this. No one I have talked to knows how to solve this.", "We know Euler formula: $$ e^{ix}=\\cos(x)+i\\sin(x). $$ Does this formula work if we replace real number $x$ with complex number $z$?", "In the course of creating the content for a site, we've ended up with orphaned content nodes that are not linked to from anywhere. I'd like to find and examine these. Surprisingly, I can't find a module for this. Tiny hypothetical example: I'm building a brochureware site. Someone wrote a \"Contact\" page, someone else wrote an \"About Us\", and someone else wrote \"Directions\". The person writing \"Directions\" forgot to put it in a menu link or add a link from \"About Us\" to \"Directions\". So \"Directions\" is orphaned: there are no links to it. I'd like to find all such nodes so I can figure out what to do with them.", "Geiger and Marsden's experiment led Rutherford to believe that the positive charge and most of the mass of the atom was concentrated in a small region. I understand what led him to conclude the way the positive charge is positioned in the atom. But how did he conclude that most of the mass was in a small region (the nucleus)? How did the distribution of the mass matter after all? Given that the electric force is greater than the gravitational force by many magnitudes, the force between the positice charge and the electrons was predominantly electric. So how did Rutherford conclude that most of the mass is in the nucleus?", "Software for drawing geometry diagrams", "I'm using soul to letterspace headings in a Hungarian document and compiling it with lualatex. For some reason soul drops some of the accented letters at the end of a word, but not all. In the example below, only ő and ű are affected: \\documentclass{minimal} \\usepackage{fontspec} \\setmainfont[Ligatures = TeX]{TeX Gyre Pagella} \\usepackage{soul} \\begin{document} \\noindent \\so{áll llá ÁLL LLÁ}\\\\ \\so{íll llí ÍLL LLÍ}\\\\ \\so{űll llű ŰLL LLŰ}\\\\ \\so{őll llő ŐLL LLŐ}\\\\ \\so{üll llü ÜLL LLÜ}\\\\ \\so{öll llö ÖLL LLÖ}\\\\ \\so{úll llú ÚLL LLÚ}\\\\ \\so{óll lló ÓLL LLÓ}\\\\ \\so{éll llé ÉLL LLÉ} \\end{document}", "We know that if you (using Polyjuice), take the form of someone who had been injured, you assume that injured form (e.g. Barty/Moody). If you are injured, presumably you would be uninjured while under Polyjuice. My question is, is this in real-time? That is, if you take a Polyjuice, and while you're still under its effects, the person being transformed into gets injured (or even dies), will that injury be transferred onto you? And conversely, if you get injured while in someone else's body, will that transfer over to your real body after the Polyjuice wears off, will it disappear, or will it go to the person you turned into?", "How can I execute `date` inside of a cron tab job?", "The Python docs say: re.MULTILINE: When specified, the pattern character '^' matches at the beginning of the string and at the beginning of each line (immediately following each newline)... By default, '^' matches only at the beginning of the string... So what's going on when I get the following unexpected result? &gt;&gt;&gt; import re &gt;&gt;&gt; s = \"\"\"// The quick brown fox. ... // Jumped over the lazy dog.\"\"\" &gt;&gt;&gt; re.sub('^//', '', s, re.MULTILINE) ' The quick brown fox.\\n// Jumped over the lazy dog.'", "How to set page geometry for a single page only?", "Cleaning wax and pesticide from apple skin I love apples. I like to eat them with skin as it has plenty of fiber in the skin. But apples are famous for wax and pesticides on the skin which I don’t want to ingest. I have read many articles on the web and suggestions for removing the wax from the surface. These suggestions include soaking in vinegar or hot water and other methods. They suggest that soaking apples in vinegar removes the wax that can be seen in the vinegar. I have done that, but never seen any residue of wax in the vinegar. So I have set aside a new kitchen sink Scotch-Brite scrubber for this purpose and been scrubbing the apple skin under running water before eating. I think this method should remove most of the wax and pesticides. I would like to hear your input." ]

[ "Do we need to unbind event listeners in directives when angular starts to destroy?", "Kworker, what is it and why is it hogging so much CPU?", "Every time since a few days ago after I caught Mespirit, when I go to the portal in the Nameless Cavern and I press A to interact. All that happens is a short dialog sequence and nothing else. I know the requirements are along the lines of having 3 max happiness Pokemon with you in your party which I do. I have also downloaded the recent update/patch from the eShop if that helps at all. How can I make Uxie and Azelf appear in the cavern?", "I am developing an offline installer for all versions of Ubuntu, and I need Ubuntu's default installed packages list. Is there a way to get this information from any server (web server)? Any script to fetch any Ubuntu version's default installed packages list. I will give the Ubuntu version, and the script will fetch the packages list. Note: I need at least a server address. I can write a script for this.", "What formats supporting animation are suitable for the web?", "Proof that $\\frac {1} {2\\pi i} \\oint \\frac {{\\rm d}z} {P(z)} $ over a closed curve is zero. Prove that $$\\frac {1} {2\\pi i} \\oint \\frac {{\\rm d}z} {P(z)} $$ over a closed smooth simple curve that contains all of the roots of the polynomial $P(z)$ is either zero if $n \\geq 2$ or equals $\\frac{1} {a_0} $ if it's degree is $1$. Proof: $n\\geq 2$ $$\\frac {1} {P(z)=(z-z_0)(z-z_1)\\dots(z-z_n)}$$ So after partial decomposition of the fraction I'll have something like $$\\frac {A} {z-z_0} +\\frac{B} {z-z_1}+\\cdots$$ where $A,B \\in \\mathbb{C}$ (Is this fact true that $A,B$ wont be polynomials and just coefficients I can see it why in an intuitive way but cannot write a full proof of it for the decomposition trying to get a linear system or something) then use Cauchy's theorem and integrate all of these on different circles with their center at each root and argue that the integral is the same as the sum of those circle integrals. Now since $\\frac {1}{z-z_n}$ will be analytic inside the circle when I'm integrating on circles that do not contain $z_n$ some of those integrals will be zero. and now since my curves are of the form $\\gamma(t)=z_n+e^{it}$ , $t \\in [0,2\\pi]$ the rest of the integrals will look like $$\\int_0^{2\\pi} \\frac{Aie^{ti}} {e^{it}}\\,{\\rm d}t $$ and all of them will be $A_i$. Is my proof correct? Only part I cannot show is that I won't have any problem with decomposing the fraction. And I'm also using the assumption that after the decomposition I'll have as numerators simple complex numbers not not functions of any kind.", "How to space columns evenly in a table with multicolumns?", "Array with labeling columns", "I am running Ubuntu 14.04 on think-pad T450. When using an external monitor with higher resolution than the in-built laptop screen, the text of dialog boxes are getting messed up. Looks like I need to replace the Graphic card driver. Anyone found a solution to this? Updated to add requested information: lspci -nnk | grep '\\[03' -A2 gives the following: 00:02.0 VGA compatible controller [0300]: Intel Corporation Broadwell-U Integrated Graphics [8086:1616] (rev 09) Subsystem: Lenovo Device [17aa:5034] Kernel driver in use: i915 Below is a screenshot, see how the letters are messed up on the screen.", "How do you force constructor signatures and static methods? Is there a way of forcing a (child) class to have constructors with particular signatures or particular static methods in C# or Java? You can't obviously use interfaces for this, and I know that it will have a limited usage. One instance in which I do find it useful is when you want to enforce some design guideline, for example: Exceptions They should all have the four canonical constructors, but there is no way to enforce it. You have to rely on a tool like FxCop (C# case) to catch these. Operators There is no contract that specifies that two classes can be summed (with operator+ in C#) Is there any design pattern to work around this limitation? What construct could be added to the language to overcome this limitation in future versions of C# or Java?", "I'm writing up some notes that will be displayed on an overhead projector. The standard time-derivative \\dot{x} produces a dot that is hard to see. Does anyone know of a package or have a macro that produces a (nice looking) larger dot? Similarly with \\ddot{x}. At the moment, I've been supplied with some ugly code that produces an ugly output: \\def\\dt#1{{\\buildrel {\\hbox{\\LARGE . }} \\over {#1}}} % dot-over \\def\\ddt#1{{\\buildrel {\\hbox{\\LARGE ..}} \\over {#1}}} % double dot", "How to force Logger.debug output in Play! framework specs2 tests?", "I have brand new machine. I want to install Ubuntu and one more Linux distributions on same machine. When the machine is up I want to have the option to choose which Linux to load. Is it possible? How to do it?", "What's going on with \"compact implies sequentially compact\"? I've seen both counterexamples and proofs to &quot;compact implies sequentially compact&quot;, and I'm not sure what's going on. Apparently there are compact spaces which are not sequentially compact; quick googling and wikipedia checks will turn up examples floating around; they tend to be variants of $[0,1]^{[0,1]}$ with the product topology. Here's a demonstration(?): $[0,1]^{[0,1]}$ is compact by Tychonoff's theorem. So, we demonstrate failure of sequential compactness. Choose a unique binary representation for each $x\\in [0,1]$. For each $n\\in\\mathbb{N}$, let $f_n : [0,1]\\to[0,1]$ (an element of $[0,1]^{[0,1]}$) be the function which maps each $x$ to its $n$-th place digit in its binary expansion. Let $f_{n_k}$ be a subsequence of this sequence. Let $x'\\in [0,1]$ be such that the $n_{2m}$-th digit is $0$ and the $n_{2m+1}$-th digit is $1$, for all $m\\in\\mathbb{N}$. Then $f_{n_k} (x')$ does not converge (it alternates between $0$ and $1$), and hence $f_{n_k}$ cannot converge. Thus we have found a sequence in $[0,1]^{[0,1]}$ without any convergent subsequence and so it is not sequentially compact. (Aside: this is apparently based off of an example in Steen's Counterexamples in Topology, according to ) Nevertheless, there's also some proofs(?) floating around that compactness of a space implies sequential compactness, along these lines (this proof(?) is of the contrapositive): Suppose $X$ is not sequentially compact. By definition, this means there is some sequence $(x_n)$ over $X$ with no convergent subsequence. If any $x\\in X$ had for each of its neighborhood $U$ infinitely many $n$ for which $x_n \\in U$, then we could define a convergent subsequence of $(x_n)$, contradicting our assumption. (Presumably this is done by choosing for each neighborhood a sufficiently-large-indexed term in that neighborhood.) Thus, for each $x \\in X$ we can select an open set $U_x$ such that $x\\in U_x$ but with $x_n \\in U_x$ for only finitely many $n$. The collection $\\mathcal{U}=\\{U_x : x\\in X\\}$ is clearly an open cover of $X$. If $\\mathcal{U}$ had a finite subcover $\\{U_1, \\dots, U_k\\}$ then the union $U_1 \\cup \\cdots \\cup U_k$ would contain all of $X$ but only contain $x_n$ for finitely many $n$, which is impossible. Thus $X$ is not compact, since we have found an open cover without a finite subcover. (Aside: this proof is essentially the same as the proof appearing in Rudin's Principles of Mathematical Analysis for Thm 2.37 that infinite subsets of compact spaces have limit points.) So, what's going on here? It can't be that what both the counterexample and the proof are telling us is correct. Is there some subtle (or more embarassingly for me -- glaring) flaw in the proof?", "Ubuntu 14.04.5/16.04 and newer on AMD graphics", "Does the stock market create any sort of value? Sorry if the below seems like a conspiracy theory. It probably is, but I probably don't understand something. (This has bugged me to no end as long as I can remember.) Okay, so here is what I understand about the stock market? The main way money enters the stock market is through investors investing and taking money out. The only other cash flow is in through dividends and out when businesses go public. In a Ponzi scheme, there is usually some small source of income to hide the fact that it's a Ponzi scheme. Dividends are pretty insignificant. For the purposes of this question, we will only consider non-dividend stocks. When you buy stock, it is claimed that you own a small portion of the company. This statement has no backing, as you cannot exchange your stock for the company's assets. For example, if I bought $10 of Apple Stock early on, but it later went up to $399, I can't go to Apple and say \"I own $399 of you, here you go it back, give me an iPhone.\" The only way to redeem this is to sell the stock to another investor (like a Ponzi Scheme.) The stock market goes up only when more people invest in it. Although the stock market keeps tabs on Businesses, the profits of Businesses do not actually flow into the Stock Market. In particular, if no one puts money in the stock market, it doesn't matter how good the businesses do. Based on the above, it seems like the Stock Market has little to do with investing businesses to create growth, and primarily grows in a similar way to a Ponzi Scheme. (Some differences include that it is Stochastic (so when it collapses, it can be blamed on luck or the economy) and it has no top operator (similar to a Pyramid Scheme)). Am I missing something? Does the stock market create value for investors?", "I just read this very insightful post , where the author stated that the variance of $\\hat\\beta$ is: $$\\text{var}(\\hat\\beta) = \\sigma^2(\\textbf{X}^\\prime \\textbf{X})^{-1}.$$ I couldn't figure out why it is like this. Can anyone elaborate a bit?", "If the Universe is expanding, how is that galaxies run into each other? As the title says. If everything is moving outward, thrown by the Big Bang, how could two Galaxies end up with velocity vectors that run them into each other?", "Is this mold? Black? White?", "BibTeX loses capitals when creating .bbl file Titles of articles I'm about to cite contain upper case letters and when using BibTeX it converts them to lower case ones. This happens only in the title and only the first letter conserves its case. For example, when I cite an article about HF, the reader won't know if it is about Hafnium (Hf) or fluorine acid (HF). I know that I can fix it manually in the .bbl file but I would like to avoid it, or fix it automatically." ]

[ "How do Prestige Classes that advance spellcasting interact with racial spellcasting ability? For example Lets use the Marrutact from Sandstorm, it can cast as a 5th level wizard. if it then takes a prestige class that requires the ability to cast 1st level Arcane spells and advances arcane casting such as Abjurant Champion. assuming it meets all other prerequisites does the Marrutacts spellcasting improve when it takes a level in Abjurant Champion or does it gain no benefit?", "How can I depict vehicle traffic during daytime in a long exposure without washing out the vehicles?", "3.8 GPA, but 3 Fs and 1 D on transcript", "I have scripts that expect specific drive letters for hard drives. Windows sometimes assigns the different drive letters (e.g. I expected my Maxtor drive to be E:, but it's now F:, therefore my scripts will fail), depending on the order of how the drives are plugged into my laptop. In Windows 7, how do I assign a permanent drive letter to a drive?", "Site-specific spellcheck? I often see misspelled words in titles and bodies of questions, only to see them spelled properly in the tags. I have to imagine that tags are always spelled right because it's hard to type arbitrary text into the tag box. I also have to imagine that sometimes autocorrect and spellcheck provided by browsers tend to turn programming terms and package names into English words. For example, see Would it be possible to have some sort of spellchecker that compares text of titles (and maybe bodies) to known tags and offers some sort of correction (maybe red squiggles or something) when there's some statistical probability of a misspelling? Since this would be using a site's tags, \"magneto\" would get corrected to \"magento\" on SO, while \"magento\" would get corrected to \"magneto\" on aviation.stackexchange.com. In theory this could reduce a lot of stupid typos and prevent trivial edits just to fix the spelling of key words. Note that this is not solving a problem that a user's browser can already solve because browsers ship with English dictionaries, not dictionaries of programming terms. In fact, it's potentially correcting a problem created by the browser (which might have already autocorrected \"magento\" to \"magneto\").", "Prove that if $\\sum{a_n}$ converges absolutely, then $\\sum{a_n^2}$ converges absolutely I'm trying to re-learn my undergrad math, and I'm using Stephen Abbot's Understanding Analysis. In section 2.7, he has the following exercise: Exercise 2.7.5 (a) Show that if $\\sum{a_n}$ converges absolutely, then $\\sum{a_n^2}$ also converges absolutely. Does this proposition hold without absolute convergence? I'm posting about this here because my answer to that last question about whether the proposition holds without absolute convergence is \"Yes\", but my suspicions are raised by him merely asking the question. Usually questions like this are asked to point out that certain conditions are necessary in the statement of propositions, theorems, etc. I just want to see if I'm missing something here. Anyway, here's how I prove the absolute convergence of $\\sum{a_n^2}$, and note that I never use the fact that $\\sum{a_n}$ is absolutely convergent: Proof: Let $s_n = \\sum_{i=1}^n{a_n^2}$. I want to show that $(s_n)$ is a Cauchy sequence. So, let $\\epsilon &gt; 0$ and $n &gt; m$, and consider, \\begin{equation} \\begin{aligned} |s_n - s_m| &amp;= |(a_1^2 + a_2^2 + \\cdots a_n^2) - (a_1^2 + a_2^2 + \\cdots a_m^2)|\\\\ &amp;= |(a_{m+1})^2 + (a_{m+2})^2 + \\cdots + a_n^2|\\\\ &amp;= |a_{m+1}|^2 + |a_{m+2}|^2 + \\cdots + |a_n|^2\\\\ \\end{aligned} \\end{equation} Now, since $\\sum{a_m}$ converges, the sequence $(a_m)$ has limit 0. Therefore I can choose an $N$ such that $|a_m| &lt; \\sqrt{\\epsilon/n}$ for all $m &gt; N$. So for all $n &gt; m&gt; N$, we have, \\begin{equation} \\begin{aligned} |s_n - s_m| &amp;= |a_{m+1}|^2 + |a_{m+2}|^2 + \\cdots + |a_n|^2\\\\ &amp;&lt; \\left(\\sqrt{\\frac{\\epsilon}{n}}\\right)^2 + \\left(\\sqrt{\\frac{\\epsilon}{n}}\\right)^2 + \\cdots + \\left(\\sqrt{\\frac{\\epsilon}{n}}\\right)^2\\\\ &amp;&lt; \\left(\\sqrt{\\frac{\\epsilon}{n-m}}\\right)^2 + \\left(\\sqrt{\\frac{\\epsilon}{n-m}}\\right)^2 + \\cdots + \\left(\\sqrt{\\frac{\\epsilon}{n-m}}\\right)^2\\\\ &amp;= \\epsilon \\end{aligned} \\end{equation} Therefore $(s_n)$ is Cauchy and $\\sum{a_n^2}$ converges. And since $\\sum{a_n^2} = \\sum{|a_n^2|}$, the series $\\sum{a_n^2}$ is absolutely convergent. &#x220E; Am I doing something wrong here? Am I right in thinking that $\\sum{a_n}$ need not be absolutely convergent for $\\sum{a_n^2}$ to be absolutely convergent?", "Generating samples from singular Gaussian distribution Let random vector $x = (x_1,...,x_n)$ follow multivariate normal distribution with mean $m$ and covariance matrix $S$. If $S$ is symmetric and positive definite (which is the usual case) then one can generate random samples from $x$ by first sampling indepently $r_1,...,r_n$ from standard normal and then using formula $m + Lr$, where $L$ is the Cholesky lower factor so that $S=LL^T$ and $r = (r_1,...,r_n)^T$. What about if one wants samples from singular Gaussian i.e. $S$ is still symmetric but not more positive definite (only positive semi-definite). We can assume also that the variances (diagonal elements of $S$) are strictly positive. Then some elements of $x$ must have linear relationship and the distribution actually lies in lower dimensional space with dimension $&lt;n$, right? It is obvious that if e.g. $n=2, m = \\begin{bmatrix} 0 \\\\ 0 \\end{bmatrix}, S = \\begin{bmatrix} 1 &amp; 1 \\\\ 1 &amp; 1\\end{bmatrix}$ then one can generate $x_1 \\sim N(0,1)$ and set $x_2=x_1$ since they are fully correlated. However, is there any good methods for generating samples for general case $n&gt;2$? I guess one needs first to be able identify the lower dimensional subspace, then move to that space where one will have valid covariance matrix, then sample from it and finally deduce the values for the linearly dependent variables from this lower-dimensional sample. But what is the best way to that in practice? Can someone point me to books or articles that deal with the topic; I could not find one.", "Sum of the series $1+\\frac{1\\cdot 3}{6}+\\frac{1\\cdot3\\cdot5}{6\\cdot8}+\\cdots$", "Recording claimable expenses in GnuCash I am new to accounting and trying to learn a few things as my accounts get more and more complicated. I currently use GnuCash to record simple income/expenses/assets/liabilities and have had a new situation I don't know how to record. I am currently billing some expenses for work and for my kayak club to my personal credit card. Under normal circumstances I would do the following (my +/- may be backwards): Expense +$100 Credit Card -$100 and then when the credit card bill comes I would pay it off Credit Card +$100 Chequing Account -$100 For expenses that I get reimbursements for I would like to be able to note that I paid for the expense with my credit card and that I paid off my credit card with my chequing account. At the same time, I would like to be able to create another parent account (maybe \"claimable expenses\") that shows that I purchased the item, and was then reimbursed so that an individual expense for work or my club has a zero balance. I tried to look this up in previous threads but didn't quite understand how to apply this to my situation Any advice would be appreciated.", "How do I install different (upgrade or downgrade) PHP version in still supported Ubuntu release?", "Moderncv package - cventry date width I am writing my CV using moderncv package, everythig is nice but I have a problem with \\cventry command. I have something like this: (it means 2010 - now) I would want to have this in one line, rather than in two lines. I tried looking into the moderncv style files but with no success. What can I do to achieve the effect I want?", "How to convert a HEIF/HEIC image to JPEG in El Capitan? So, here’s the thing. I have a new iPhone and an old Mac. iOS 11 (still in beta as of today) and El Capitan (no more updates for this Mac). I use iCloud photo library in both devices. When I take a photo in the new format with my iPhone 7, is there any way to use it right away in my mac, without having to convert it in my iPhone first? I mean, can I get those photos synced through iCloud and converted locally on my Mac? I have tried to find a third party software that could do that kind of conversion, but was not able to find any that would work on El Capitan. Any idea?", "Is there any way to increase the drop rate of items? Some items in Terraria drop only very rarely from certain enemies. It's a pain having to farm so many enemies to try to get these rare items. Is there any way to make them drop more often?", "I'm trying to create globally-unique identifiers in JavaScript. I'm not sure what routines are available on all browsers, how &quot;random&quot; and seeded the built-in random number generator is, etc. The GUID / UUID should be at least 32 characters and should stay in the ASCII range to avoid trouble when passing them around.", "Proving $\\lim_{n\\to\\infty} a^{\\frac{1}{n}}=1$ by definition of limit given a sequence $a_n=a^{\\frac{1}{n}}$ for $n\\in\\mathbb{N}^*$, $a\\in\\mathbb{R},a&gt;1$ then proof that $\\lim\\limits_{n\\to+\\infty}a_n=1$ by definition. proof: given $a_n=a^{\\frac{1}{n}}$ for $a\\in\\mathbb{R},a&gt;1$. for $n\\in\\mathbb{N}^*,n+1&gt;n\\Rightarrow \\frac{1}{n+1}&lt;\\frac{1}{n}$ and because $a&gt;1$ we gets $a^{\\frac{1}{n+1}}&lt;a^{\\frac{1}{n}}$, since $\\frac{1}{n+1}&gt;0$, then $1=a^{0}&lt;a^{\\frac{1}{n+1}}&lt;a^{\\frac{1}{n}}\\Rightarrow 1&lt;a_{n+1}&lt;a_{n}$. then we proof that $\\lim\\limits_{n\\to+\\infty}a_n=1$ we need to show that $\\forall\\epsilon&gt;0,\\exists N,\\forall n&gt;N,|a_n-1|&lt;\\epsilon$ then for $\\epsilon&gt;0$, choose $N=\\frac{1}{\\log_a(\\epsilon+1)}$, since $a&gt;1$ we gets that $$\\forall n&gt;N,1&lt;a^{\\frac{1}{n}}&lt;a^\\frac{1}{N}\\Rightarrow0&lt;a^{\\frac{1}{n}}-1&lt;a^{\\frac{1}{N}}-1\\Rightarrow |a^{\\frac{1}{n}}-1|&lt;|a^{\\frac{1}{N}}-1|=|a^{\\log_a(\\epsilon+1)}-1|=|\\epsilon+1-1|=\\epsilon\\Rightarrow |a^{\\frac{1}{n}}-1|&lt;\\epsilon$$ wich implies that $\\lim\\limits_{n\\to+\\infty}a_n=1\\square$ my proof to the limit is correct?", "This question aims to create an &quot;&quot; of numerous questions that ask about determinants of specific matrices (I may have missed a few): The general question of this type is Let $A$ be a square matrix of rank$~1$, let $I$ the identity matrix of the same size, and $\\lambda$ a scalar. What is the determinant of $A+\\lambda I$? A clearly very closely related question is What is the characteristic polynomial of a matrix $A$ of rank$~1$?", "match first column of file a with paragraphs of file b I have 2 files. The first, fileA looks like TCONS_00000066 XLOC_000030 - u q1:XLOC_000030|TCONS_00000066|0|0.000000|0.000000|0.000000|0.000000|- TCONS_00000130 XLOC_000057 - u q1:XLOC_000057|TCONS_00000130|0|0.000000|0.000000|0.000000|0.000000|- TCONS_00000395 XLOC_000206 - u q1:XLOC_000204|TCONS_00000393|0|0.000000|0.000000|0.000000|0.000000|- FileB looks like: &gt;TCONS_00000001 gene=XLOC_000001 AGATGAGCTGGTGGGGATGCTCTAAGAGAACGAGAGAAGCACAGAGCAGATAAACCACACCCACAGGCAC CACCGTCCTTGTTGGTAATGAAGAAGACGAGACGACGACTTCCCCACTAGGAAACACGACGGAGGCGGAG ATGATCGACGGCGGAGAGAGCTACAGAAACATCGATGCCTCCTGTCCAATCCCCCCATCCCATTCGGTAG TTGGATTGAAGACTACCGAATAAGAGAAGCAGGCAGGCAGACAAACCCTTGAACCAAGGAGTCCTCGCTG AGGAAGCTTTGGATCCACGACGCAGCTATGGCCTCCCCGCCCACCAGGCCGCCAGCCACAACCAGCTGAC TAGGTCGCATGCATCATCAGATTTCAATCTCCCTTCGTTCCCTGTCCCTAATCCAATACCAATAGGGAGC AATCAGCTGCTCCTCGACGGCGAGGGAGATGTCGTCGGCCGCGGGCCAAGACAACGGAGATACCGCTGGG GACTACATCAAGTGGATGTGCGGCGCCGGTGGCCGTGCGGGCGGCGCCATGGCCAACCTCCAGCGCGGCG TTGGCTCCCTCGTCCGTGACATTGGCGACCCCTGCCTCAACCCATCCCCCGTTAAGGGGAGCAAAATGCT CAAACCGGAAAAATGGCACACATGTTTTGATAATGATGGAAAGGTCATAGGTTTCCGTAAAGCCCTAAAA TTCATTGTCTTAGGGGGTGTGGATCCCACTATTCGAGCTGAAGTTTGGGAATTTCTTCTTGGCTGCTATG CCTTGAGTAGTACCTCAGAGTATAGGAGGAAACTAAGAGCTGTTAGAAGGGAAAAATATCAAATTTTAGT TAGACAGTGCCAGAGCATGCACCCAAGCATTGGTACAGGTGAGCTTGCTTACGCTGTTGGATCAAAGCTA Now, fileA contains selected transcript numbers in the first column and fileB contains sequences of all transcripts. I want to scan fileB for the first column of fileA and print the trailing sequences of matching transcripts along with the transcript number.", "We use unit length Quaternion to represent rotations. Following is a general rotation matrix obtained ${\\begin{bmatrix}m_{00} &amp; m_{01}&amp;m_{02} \\\\ m_{10} &amp; m_{11}&amp;m_{12}\\\\ m_{20} &amp; m_{21}&amp;m_{22}\\end{bmatrix}}_{3\\times 3}\\tag 1 $. How do I accurately calculate quaternion $q = q_1i+q_2j+q_3k+q_4$for this matrix?Means how can we write $q_i$s interms of given $m_{ij}$ accurately?", "How to make hair material different from the plane itself? In Cycles Render, I added hair to a plane (as I was making a grass field) and I don't seem to know how to make the actual flat plane's material different from the hairs themselves, because I'd like to make the plane have an image texture and the hairs have a yellow-like color to them, but of course, if I attempt to make the material yellow-ish, the plane AND the hairs will become yellow. I'm done with the plane, I just want to control the hairs' materials.", "How do I reference photographs with a separate numbering system to figures in latex? I am writing a book, and would like to be able to have the photographs labelled with an independent numbering system to my figures. In the text I would refer to, for example, figure X and separately to photograph X, so I want them to have different numbering systems, just as equations and figures do. Is it possible to have a different \\begin{figure} environment so that the numbering can be separated?" ]

[ "Check for missing fonts/characters in XeLaTeX?", "How do I find the package that provides a file?", "How to change the desktop wallpaper to a photo of my own selection in Ubuntu 18.04? I'm not interested in downloading some wallpaper changer application, nor am I interested in coding something up. There has to be an easy way to select a photo as a custom wallpaper in Ubuntu 18.04.", "Print out elements from an array with a comma between elements except the last word", "I am studying homology groups and I am looking to try and develop, if possible, a little more intuition about what they actually mean. I've only been studying homology for a short while, so if possible I would prefer it if this could be kept relatively simple, but I imagine it is entirely possible there is no real answer to my query anyway. As I said above, I want to gain a little deeper understanding of what the n-th homology group actually means: I can happily calculate away using Mayer-Vietoris but it doesn't really give me a great deal of intuition about what the n-th homology group actually means. For example, with homotopy groups, the fundamental group is in some sense a description of how loops behave on the object in question, and it is obvious to me why that is what it is for say, the torus or the circle. However, I have no idea what, if anything, I am actually saying about a triangulable object when I talk about it having 0-th homology group this or 1st homology group that. The best I have been able to find online or in my limited book selection is the brief description \"intuitively, the zeroth homology group counts how many disjoint pieces make up the shape and gives that many copies of $\\Bbb Z$, while the other homology groups count different types of holes\". What 'different types of holes' are there, roughly speaking? I appreciate that it may often be completely non-obvious what the low-order homology groups are for some complicated construction, but perhaps in simpler examples it might be more explicable. Are there (simple) cases where I could say, just from looking something like e.g. the torus, what its zero-th or first or second etc. homology group was based on the nature of the object? I guess in the zero-th case it is, as my source () above says, related to the number of disjoint pieces. Can we delve deeper than this for the other homology groups? Any book/website suggestions would be welcomed (preferably websites as I am nowhere near a library!) - I have Hatcher but not a great deal else, and I haven't gleaned as much as I wish to from that alone. Of course I know that there is a great deal we don't know about homology groups even today, so I don't expect some magical all-encompassing answer, but any thoughts you could provide would be appreciated. I hope this question is appropriate for SE Mathematics, apologies if not! -M", "Is it correct to use that/which in the relative clause when it is referring to the place as an object pronoun?", "How do I recover the Facebook account password? I have forgotten my Facebook account password and also I have no access to the number which I use to log-in to Facebook account. On this page (see the image below) they are asking for a government photo-ID to verify my account. The problem is that I don't have a driving license, voter ID card, passport etc. All I have is a school ID card but that hasn't worked for me. Is there any other way to recover my password?", "Lower case \"k\" in Cocoa I know this is a common convention, but what does the \"k\" in variable names signify? (i.e. kMaxImageViewSize) I looked in the Apple documentation on Variable names and found no mention of it. Thanks for answering", "I use Gingerbread. My Android phone has feature, that turns off display during call when I put the phone to my ear. However, the sensor is probably over-sensitive in my device, so it often turns off during call even when I don't keep it next to my face. This is an issue if I want to use keyboard during call when the screen turns off. Can I disable this feature?", "How to programmatically click a button in WPF?", "My network includes machines running Linux and others running Windows. And my machine is running Linux.", "Stuck on two valid squares in minesweeper How to solve? The 1 indicates that ones of the two questioned flags is a mine and 3 also indicates the same. How to choose logically between any one of them?", "$f(x)f(1/x)=f(x)+f(1/x)$ Find a function $f(x)$ such that: $$f(x)f(1/x)=f(x)+f(1/x)$$ with $f(4)=65$. I have tried to let $f(x)$ be a general polynomial: $$a_0+a_1x+a_2x^2+\\ldots a_nx^n$$ which leaves $f(1/x)$ as: $$a_0+a_1{1\\over x}+a_2{1\\over x^2}+\\ldots + a_n{1\\over x^n}$$ On comparing the coefficients of both sides, we see that: $$2a_0=(a_0)^2+(a_1)^2+(a_2)^2+\\ldots+(a_n)^2$$ And $$a_1=(a_0a_1)+(a_1a_2)+ \\ldots +(a_{n-1}a_n)$$ I don't know how to proceed further. I know I need to compare coefficients and come to a conclusion based on their values, but I don't see what to do next.", "Finding multivariable limits for the function $\\frac{3x^2y}{x^2+y^2}$", "Is [Its'] a word? (Note the apostrophe at the end.) I just had a strange flashback to a conversation I had when I was in high school, with a man who was regarded by many members of a particular online community as having an impressive degree of knowledge of the English language. The conversation centered on a claim this man made that I found very difficult to accept. I had made some remark involving the difference between it's and its (a distinction which I trust is quite well-known to the majority of users on this site), to which he had contributed, mostly phrased as an amusing aside, that there was one more word I hadn't mentioned: its', with the apostrophe at the end. I originally thought he might have been joking, but we ended up debating this rather fervently. I seem to recall that I kept demanding he use the word in an example sentence, but he either could not or refused to do so. Yet he maintained that it is a word. Is this true? I must concede I haven't put a lot of thought into it just now; but at the time, I was perplexed by the very suggestion that it could be a word (what could it mean?), and at the moment I can't really think of any scenario where it would make any sense.", "Copy a file back to local system with ssh If I'm logged in to a system via SSH, is there a way to copy a file back to my local system without firing up another terminal or screen session and doing scp or something similar or without doing SSH from the remote system back to the local system?", "Age replacement policy for hard disks and SSDs at servers I'm planing an age replacement policy for our storage and servers. Most of them are for DBs and some for images (static content) so yes, they have an huge I/O everytime. Also, we use Samsung 840 Pro SSDs for the RAID Controllers (PERC H700i) as CacheCade. Are you guys managing the replacement of old hard drives and solid state drives?", "If we remove the square in the upper right corner of a $8\\times 8$ chessboard. The question is: Is it possible to cover the entire remaining area, with $1\\times 3$ chocolate bars? (they can be laid on the chessboard vertically and horizontally aswell) For the answer: We know that there will be $63$ squares left on the chessboard, of which $32$ are white and $31$ are black, since the one in the upper right corner was black. $63$ is divisible by $3$, so it could be possible to cover the area, but that doesn't prove that an arrangement exists to do it. I'm not sure how to continue and am seeking help. Thanks.", "What is the difference between ref and out parameters in .NET? What are the situations where one can be more useful than the other? What would be a code snippet where one can be used and another can't?", "Shell Script - how to scp into remote server and download files and protect password" ]

[ "Why is there an unexplainable gap between these inline-block div elements?", "How to switch window controls to the left (Gnome Shell)? Is there a way to the switch gnome-shell window buttons to the left? I've gotten so used to them being on the left that them being on the right has thrown me way off. (gnome shell has them defaulted to the right corner)", "Getting \"Not found\" message when running a 32-bit binary on a 64-bit system", "Error: Declaration of MyClass::start_lvl() should be compatible with that of Walker_Nav_Menu::start_lvl()", "Keep items in inventory on death in Minecraft I once played a vanilla Minecraft adventure map (called \"Herobrine's Mansion\") that prevented the player from losing their items on death. Which commands can be used to prevent the player from losing their items on death (in vanilla Minecraft)?", "Prove that ${\\sqrt {n} }^{\\sqrt {n+1}} > {\\sqrt {n+1}}^{\\sqrt {n}}$.", "Introduction to statistics for mathematicians What is a good introduction to statistics for a mathematician who is already well-versed in probability? I have two distinct motivations for asking, which may well lead to different suggestions: I'd like to better understand the statistics motivation behind many problems considered by probabilists. I'd like to know how to better interpret the results of Monte Carlo simulations which I sometimes do to form mathematical conjectures. I'm open to the possibility that the best way to go is not to look for something like \"Statistics for Probabilists\" and just go to a more introductory source.", "Execute managebean method from javascript onload event", "What is the difference between Python's list methods append and extend?", "Are proofs by contradiction really logical? Let's say that I prove statement $A$ by showing that the negation of $A$ leads to a contradiction. My question is this: How does one go from \"so there's a contradiction if we don't have $A$\" to concluding that \"we have $A$\"? That, to me, seems the exact opposite of logical. It sounds like we say \"so, I'll have a really big problem if this thing isn't true, so out of convenience, I am just going to act like it's true\".", "How to put a unique material on duplicated objects separately? I've a sphere and then duplicated it. In object tree they are displayed as three siblings. I selected on of them and created a green glass material through node editor however this material was assigned to all three spheres. I confirmed that my selection is only on one sphere. What am I missing?", "On every boot up I get this: For about 10 seconds (or more) before the \"normal\" Ubuntu Gnome loading screen and the login screen comes up. I've read some questions and a bug report about this already, but this problem was dismissed as a minor inconvenience or there were no real solutions (that worked for me). For me, this problem leads to an unacceptable slow boot compared to Ubuntu (Unity) or Windows. Does anybody know how to fix this or is this a \"feature\" of Ubuntu Gnome and not a bug?", "What prevents this magnetic perpetuum mobile from working?", "Prove that to each $\\epsilon >0$, there exists a $\\delta >0$ so that the Lebesgue integral... Suppose $f$ is in $L^1$ space of $\\mu$, where $\\mu$ is the Lebesgue measure. Prove that to each $\\epsilon &gt;0$, there exists a $\\delta &gt;0$ so that the Lebesgue integral of the absolute value of $f$ is less than $\\epsilon$ (over the set $E$) whenever the measure of $E$ is less than $\\delta$. I know that the integral of $f$ is finite. So for arbitrary $f$ we can find the integral of $f$ to be less than some $\\epsilon$, but how would I connect that with the measure of $E$ less than $\\delta$. Any help would be welcome.", "How do I include lines in resolv.conf that won't get lost on reboot?", "Templated check for the existence of a class member function?", "When the loop is the figure shown below will be rotated in clockwise direction the the slip ring connected to the red segment of the loop will give us the positive voltage and the slip ring connected to the black segment of the loop will give us negative voltage according to the Flemings right hand rule. What if the loop is rotated in counter clockwise direction ? Will the slip rings provide us the same polarities which they were giving when the loop was moving clockwise ? Plus The voltage from the loop is given by the equation. V(t) = Vmaximum * sin (theta) Where theta is the positive angle the red segment makes in the clockwise direction or in counter clockwise direction from this position ?", "Which packages should be loaded after hyperref instead of before?", "Looking for a (short?) story about a cryo ship looking for habitable planets I read this story/novella at least 15 years ago, probably 20 or more. It is about a ship, travelling through the universe, looking for habitable planets. Why, I can't remember. People are held in Cryo Stasis and I think they are wearing nothing in the chamber but some kind of mesh. Every time the ship gets close to a planet it wakes one or two of the people (one woman, one man?) to check it out but they never find anything good. I think in the end they wake up and discover, that they have arrived back at Earth. Other details are very vague but I seem to recall there was lots of stuff about a (blue?) light, dreaming/dreams and something about the cold, or cold blue lights or similar. Does that ring a bell for anyone?", "Best way to get last identity inserted in a table" ]

[ "Can I safely charge my laptop with a non-standard, third-party charger? I have a Toshiba Satellite laptop. My charger has stopped working. I have access to a Lenovo charger. Can I use this charger on my laptop?", "$Q_8$ is isomorphic to a subgroup of $S_8$, but not isomorphic to a subgroup of $S_n$ for $n\\leq 7$. Question is to prove that : $Q_8$ is isomorphic to a subgroup of $S_8$, but not isomorphic to a subgroup of $S_n$ for $n\\leq 7$. I see that $Q_8$ is isomorphic to subgroup of $S_8$ by left multiplication action. Hint given was to prove that stabilizer of any point contains $\\{\\pm 1\\}$. To prove Cayley's theorem, stating any group is isomorphic to a subgroup of $S_n$ we take action of given group on a set $A$ having same cardinality. with that motivation I want to check if there is a Isomorphism then there is a map from $G\\times A \\rightarrow A$. i.e., $G$ gives a permutation group $S_A$. I tried in same manner. Suppose $Q_8$ is isomorphic to subgroup of $S_n$ with $n\\leq 7$ then it should come from a group action of $Q_8$ on a set of cardinality atmost 7. Suppose $Q_8$ acts on a set $A$ with possible cardinality at most 7. $stab(a)=\\{g\\in Q_8 : g.a=g \\forall a\\in A \\}$ $cl(a)=\\{g.a : g\\in Q_8\\}$ I know number of elements in class of $a$ equals to index of stabilizer. As $cl(a)=\\{g.a : g\\in Q_8\\}\\in A$ i.e., $cl(a)\\subseteq A$ and as $|A|\\leq 7$ i see that $|cl(a)|\\leq 7$. But, $|cl(a)|=|Q_8:stab(a)|$ for any element $a\\in A$. So, $|Q_8:stab(a)|=|cl(a)|\\leq 7$ for all $a\\in A$. So, $stab(a)$ should be non trivial subgroup of $Q_8$ if not then $|Q_8:stab(a)|=8$ non trivial subgroup (proper) of $Q_8$ contains $\\{\\pm1\\}$. So, In the worst case, $\\{\\pm 1\\}\\subseteq stab(a)$ for all $a\\in A$. As $Ker(\\eta)=\\cap_{a\\in A}stab(a)$ (where $\\eta$ is the action of $Q_8$ on $A$) we see that $\\{\\pm 1\\}\\subseteq Ket(\\eta)$ which means that $Ker(\\eta)$ is non trivial. thus there is no isomorphism (coming from $\\eta$) between $Q_8$ and any subgroup of $S_7$. I would be thankful if someone can check whether my approach is correct or if there is any other simple possible way. P.S : Usually what i do to see whether two groups are isomorphic or not is to check for cardinality, abelian property, no of elements with same order and so on. But I was having no idea when i fail in all these ways. With this Group actions i could see possibility for getting a precise conclusion on Isomorphisms.I would like to Thank Mr. Jyrki Lahtonen (a user of Math.SE) who made me to get used to Group actions. P.S $2$: If any thing is wrong in my idea, it is entirely my fault, and if anything is correct in this whole credit should go to Mr. Jyrki Lahtonen", "I have a script that I need to execute on an NTFS partition. The script's permission is set to 600. I attempted to modify the permissions by running chmod 755 script.sh, which doesn't report a failure or anything - but it also doesn't change the permissions on the file: $ stat script.sh File: `script.sh' Size: 297070 Blocks: 584 IO Block: 4096 regular file Device: 811h/2065d Inode: 35515 Links: 1 Access: (0600/-rw-------) Uid: ( 1000/ xxxxxx) Gid: ( 1000/ xxxxxx) Access: 2010-09-30 14:05:16.041621000 -0700 Modify: 2010-09-30 14:05:05.070157000 -0700 Change: 2010-09-30 14:05:05.070475000 -0700 $ chmod 755 script.sh $ stat script.sh File: `script.sh' Size: 297070 Blocks: 584 IO Block: 4096 regular file Device: 811h/2065d Inode: 35515 Links: 1 Access: (0600/-rw-------) Uid: ( 1000/ xxxxxx) Gid: ( 1000/ xxxxxx) Access: 2010-09-30 14:05:16.041621000 -0700 Modify: 2010-09-30 14:05:05.070157000 -0700 Change: 2010-09-30 14:05:05.070475000 -0700 As you can see, it remains unchanged.", "Is there a program to mine bitcoins in ubuntu 13.10?", "How to get own process pid from the command prompt in Windows I'm trying to find a way to get my own PID from a command prompt (for later use in bat scripts). So far the only useful way I found was to use getpids.exe from here : , but I'm looking for a command that's \"built in\" to Windows. I'm looking for a \"bullet proof\" way. No assumptions about my process being the only cmd.exe or anything.", "Pros and Cons of a Decentralized Puppet Architecture We have around 300 RHEL servers that are currently connecting to a Puppetmaster server. However, we have noticed some performance bottlenecks and it is the point of failure in our system. I am fairly new to puppet in general and I am considering creating a decentralized puppet architecture instead of having Puppet clients connect to the Puppetmaster server. Aside from what I would suspect to happen such as performance gain and lack of signing and exchanging SSL certs for new machines, what are other pros and cons to setting up a decentralized architecture?", "I am trying to write the Euclidean algorithm in the following way: $A = \\lfloor A \\div B \\rfloor \\times B + (\\text{remainder of}) \\: A \\div B $ Now is there any symbol I can use to say \"remainder of A $\\div$ B\"? I know that in the C programming language there is the operator % for modulus; is that a valid symbol in maths? Can I write A % B? Or is there some other way?", "How do I get a Realtek RTL8723BE wireless card to work?", "Book about classical mechanics I am looking for a book about \"advanced\" classical mechanics. By advanced I mean a book considering directly Lagrangian and Hamiltonian formulation, and also providing a firm basis in the geometrical consideration related to these to formalism (like tangent bundle, cotangent bundle, 1-form, 2-form, etc.). I have , but I would like to go into more details about the [symplectic] geometrical and mathematical foundations of classical mechanics. Additional note: A chapter about relativistic Hamiltonian dynamics would be a good thing.", "Suppose that $f$ is analytic on a close curve γ. Prove or disprove $\\int_\\gamma \\overline{f(z)}f'(z)dz$ is purely imagine. Suppose that $f$ is analytic on a close curve γ. Prove or disprove $$\\int_\\gamma \\overline{f(z)}f'(z)dz$$ is purely imagine. I know that $f$ is analytic on a close curve, then $$\\int_\\gamma f(z) dz=0$$ I tried an example with $\\gamma =e^{it}$ with $0\\leq t\\leq 2\\pi$, I often get the real part of the integral equal zero. I tried let $f=u+iv$ so $f'=u_x+iv_x$. Since $f=u+iv$, $\\overline{f}=u-iv$ $$\\overline{f(z)}f'(z)=uu_x+vv_x+i(uv_x-vu_x)$$ But this doesn't get me anywhere. Any help would be greatly appreciated.", "How to install Google Chrome", "I have a little problem with the placement of my picture. I want to insert it at the end of the introduction chapter but its place is not where I want. I think the problem become from the: \\begin{figure} ... \\end{figure} Because when I insert the picture without using \\begin{figure}... the picture is at the end of the chapter as I want. Look the picture below.", "Quite often, the phrase \"x for x's sake\" is used in English, and so one could describe someone as being \"argumentative for argument's sake\" to describe someone who is arguing for the sake of arguing. However, is there an adjective that means the same thing? For example, it could be used in the context: I don't want to be [X], but [argument...] ... indicating that your argument is necessary and not intended to irritate.", "I want to show that for $\\gcd(a,b) = 1$ $a,b \\in Z$ $\\gcd(a+b, a-b) = 1$ or $\\gcd(a+b, a-b) = 2$ holds. I think the first step should look something like this: $d = \\gcd(a+b, a-b) = \\gcd(2a, a-b)$ From here I tried to proceed with two cases. 1: $a-b$ is even, which leads to $\\gcd(a+b, a-b) = 2$ 2: $a-b$ is odd, which leads to $\\gcd(a+b, a-b) = 1$ My main problem I think is, that I do not know how I should include $\\gcd(a,b) = 1$ in the proof. Any help is appreciated. Thx in advance. Cherio Woltan", "Where are the necessary places to be appended with % to remove unwanted spaces? I have experience where empty spaces cause unwanted effects. It is not easy to trace the cause of these unwanted effects. In order to eliminate any doubt, I often overuse % as follows. \\usepackage% [% left=3cm, right=3cm% ]% {geometry} or \\newcommand{\\mycommand}% {% This is my command.% } I got an extreme example that will break what Leo Liu said In fact, only spaces which would be output have to be removed by comment. The following code does not produce output, but we cannot remove the % and leave a blank line between two elements of a list below. \\newpsstyle{gridstyle} { gridwidth=0.4pt, % griddots=0 } Shortly speaking, where are the necessary places to be appended with % to remove unwanted spaces?", "How unique is the php session id? I got the impression from various things that I've read that I should not rely on two users never getting the same sessionid. Isn't it a GUID?", "My problem: Prove that a set of vectors $S$ is linearly independent if and only if any finite subset of $S$ is linearly independent. I tried like this: Suppose S is LI.Then the vector $0$ cannot be expressed as a linear sum of all elements of $S$. How it follows that a finite subset is also LI from this fact. I think $S$ can be finite or infinite. This is a question from the book Linear Algebra - Friedberg et al.", "Usually, when we see two letters put together it is to define the pronunciation or to differentiate synonyms or just its foreign origins. But some words don't seem to have any reason to double up. Why does vacuum have two of the letter U? Why does aardvark have two of the letter A? Why does llama have two of the letter L?", "What is the best solution for database connection pooling in python? I have developed some custom DAO-like classes to meet some very specialized requirements for my project that is a server-side process that does not run inside any kind of framework. The solution works great except that every time a new request is made, I open a new connection via MySQLdb.connect. What is the best \"drop in\" solution to switch this over to using connection pooling in python? I am imagining something like the commons DBCP solution for Java. The process is long running and has many threads that need to make requests, but not all at the same time... specifically they do quite a lot of work before brief bursts of writing out a chunk of their results. Edited to add: After some more searching I found which looks decent, but as I'm relatively new to python I guess I just want to make sure I'm not missing a more obvious/more idiomatic/better solution.", "If $n = p_1^{a_1} ... p_r^{a_r}$ the set of nilpotents of $\\mathbb{Z}_n$ is $(p_1 p_2 ... p_{r-1} p_r)\\Bbb Z_n$" ]

[ "Finitely generated monoids- axiomatization- compactness theorem.", "What defines a AAA game? I tried to find a precise definition. I found clues on and , but I cannot find more than an approximation like: Equivalent of blockbuster movie in cinema, an AAA game is a game with highest development budgets and levels of promotion. The definition seems imprecise. How can I be sure a game is AAA? Let's imagine a small indie studio making games and growing up. They hire more and more people through the years and invest more and more money in their game. At which milestone would their game be considered as AAA?", "Why does this cloth go down past the top surface of the cube? I was following a , and the presenter said that he did not change the default options other than enabling self-collision and increasing the collision object's friction from 5 to 10. His looks like the first image below, but when I tried that, the cloth goes down past the top surface and stops at the bottom surface (second and third images below). Why is it so? I had a previous problem with cloth, and it was due to the objects' small size. This time, I made sure that both the cloth and the cube are large enough. (Cloth=7.68*8.22*1.99m, cube = 7.68*7.68*0.897m) The project file can be .", "Cursor is set to move by increments. how to reset to normal?", "Probability, quantum physics, and why (can't it/does it) apply to macroscale events? Quantum physics dictates that there are probabilities that determine the outcome of an event, ie: the probability of a quark passing through a wall is X, due to the size of the quark in comparison to the wall), but couldn't macroscale events be predicted this same way, assuming all variables were accounted for (lets hypothetically say we have a computer powerful enough to take into account all factors). My understanding is that as the scale of an object increases, the probability of it doing anything other than what classical physics dictates is almost 0%, but could conceivably do something not predicted (Example: a human being cannot pass through a wall, but given an infinite timescale, eventually s/he would because of probability not being 0). Is this accurate? If so, then shouldn't we, (except as a tool for conceptualization, like how we round 9.8 m/s^2 or pi to 3.14), use only quantum mechanics to explain events in any scale (for more accuracy)?", "I'm in a conversation and I don't really want to leave because the people there keep adding me back so it's just whatever. But I would like to mute the conversation or something like I do on Facebook so I won't take notifications or anything from there unless I press on the group and see what's going on. Because for now I have my Skype having a new notifications every half a second. Any solutions to that?", "Is there a test to determine whether solder is leaded or lead-free? Perhaps conductivity/resistance?", "What is the difference between a teaching assistant and an instructor? It seems to me that the terms \"Teaching Assistant\" and \"Instructor\" refer to a variety of positions. At some places, a teaching assistant is responsible for things like helping the actual lecturer by handing out papers, grading homework, etc., and instructors hold recitation sessions. At other places, I saw the term \"instructor\" referring to the lecturer giving the course, while a teaching assistant is the person doing anything else (recitations, grading etc.). Is there some widely accepted definition of the two positions? For context: The question arose because I wasn't sure whether I'm using the correct terms in my CV -- I am a math graduate student, and I would like to make a distinction between jobs in which I only graded course assignments/final exams, and courses in which I held recitation classes* (and also participated in grading the final exams). Is it OK to use \"Instructor\" for the latter? What should the former be referred to as? *In the course I'm currently teaching, the recitations are planned and written by the ones giving them (without the professors' supervision). Also, the people giving the recitations are not necessarily grad students (some already hold a PhD). I'm elaborating on that because from what I've seen, some of it could be relevant for the definition of the job.", "How to prove that if $a\\equiv b \\pmod{kn}$ then $a^k\\equiv b^k \\pmod{k^2n}$", "Floquet and Bloch's theorems : connection? It is often stated that and are equivalent, even the Bloch's theorem is often referred as Floquet-Bloch theorem. However, it seems quite confusing to me since the former involves a second order differential equation (Schroedinger equation with a periodic potential) while the latter is defined for a first order one. Can someone clarify this to me? Also it would be nice if I can get references that connect the two.", "How to generate a random snowflake", "Masking problems I am working with masking. Here is my node setting with the mask. And here is my node settings And what am i getting is this. I tried invert node and many settings. It just doesnt work. Where am i going wrong", "I simply can't figure out what the capacity of this circuit is. I can do the math myself, I just need a hint how to create an equivalent circuit where it is obvious what is parallel and what is in series...", "C Scanf suddenly stopped reading in values", "how to get the current chapter name, section name, subsection name, etc? How can one get the current name of the following: Chapter, Section, Subsection(s), frame, label, mdframed?", "I want to click on file to inherit the name for the file being saved. I can't read file names in the dialog box because the color is too faint. This is the same question as That question does not have an answer but I don't have enough points to interact there so I have to post a new question. Edited to add screen shots I tried to calibrate the monitor which no effect and did not change the readability of \"unavailable\" file names. I have added screenshots of previous operating systems to compare: Please tell me how Mojave is not to blame here:", "How do you debug PHP scripts?", "Get current URL with jQuery? I am using jQuery. How do I get the path of the current URL and assign it to a variable? Example URL: http://localhost/menuname.de?foo=bar&amp;amp;number=0", "Sensitivity to initial conditions and topological transitivity Forgive the possibly naive question, but I'm returning to a basic undergrad-level study of chaotic dynamical systems and can't quite seem to reconcile the notion that in order for a dynamical system to be considered chaotic, it must have positive global Lyapunov exponents. Such exponents, of course, drive the divergence of trajectories. However, topological transitivity implies that trajectories can get arbitrarily close as well over some finite time. It seems that positive Lyapunov exponents would disallow this mixing. Is there a point at which these positive exponents no longer describe the system, and the mixing behavior begins?", "Destroying a spammer does not delete their comments" ]

[ "Why aren't particles constantly \"measured\" by the whole universe? Let's say we are doing the double slit experiment with electrons. We get an interference pattern, and if we put detectors at slits, then we get two piles pattern because we measure electrons' positions when going through slits. But an electron interacts with other particles in a lot of different ways, e.g. electric field, gravity. Seems like the whole universe is receiving information about the electron's position. Why is it not the case and the electron goes through slits \"unmeasured\"? Bonus question: in real experiments do we face the problem of not \"shielding\" particles from \"measurement\" good enough and thus getting a mix of both patterns on the screen?", "I want to do something like: MyObject myObj = GetMyObj(); // Create and fill a new object MyObject newObj = myObj.Clone(); And then make changes to the new object that are not reflected in the original object. I don't often need this functionality, so when it's been necessary, I've resorted to creating a new object and then copying each property individually, but it always leaves me with the feeling that there is a better or more elegant way of handling the situation. How can I clone or deep copy an object so that the cloned object can be modified without any changes being reflected in the original object?", "What do viruses do? There are those big green spiked things that my friends call viruses. I don't know what they do and I want to know. Do the viruses do something to the device you are playing on? Are they good or bad?", "Diagnostics for logistic regression?", "I have a huge amount of 2D-coordinates, associated with a value, e.g.: x | y | value 27.50 52.15 12.51 61.83 13.32 57.56 36.23 21.83 41.73 40.46 85.67 25.20 ... The data is not tabular and I Want the points between two data-points to be interpolated in some way (which way is not really clear, yet) I want to preset the data as heatmap like this: Is there any ready-to-use package for PSTricks or TikZ to do it?", "How to recreate subpixel anti-aliasing like Windows Command Prompt I want to be able to create a anti-aliasing effect as shown in windows command prompt with any text or vector I'd like without having to screenshot it within the program. How could I go about doing this?", "How to start a GUI application from cron?", "How do I remove duplicate \"Open With\" context menu items in Finder.app? For whatever reason, the \"Open With\" context menu in Finder is always listing every app four times (exactly). I've read about (and tried) rebuilding the Launch Services database to restore the context menu to its initial state, but nothing seems to work. I've also used Onyx.app to clear user and system caches, but I'm still left with four repetitions of each app under the \"Open With\" service. I have restarted the system a few times just to be sure it was not some temporary corruption of the list. I'm running OS X 10.6.6 on a 2011 17\" MacBook Pro with a fresh install of OS X (i.e. I didn't use Migration Assistant.app or a Time Machine backup). I did, however, sync all my preferences and other files using MobileMe like I always do, so I imagine it's feasible that a preference file somewhere is causing problems? I didn't notice whether this was happening before or after my MobileMe sync. How can I fix this so one app shows?", "Is it: My apples and orange are/is wrong? Simple question: My apples and orange are wrong or My apples and orange is wrong I am not a native English speaker, and I am having some trouble choosing between plural are or singular is for that kind of example.", "How to Solve this Arithmetic Progression Question? Please help- Four different integers form an increasing AP.One of these numbers is equal to the sum of the squares of the other three numbers.Then- find all the four numbers. I assumed the numbers to be $a,a+d,a+2d,a+3d$ and wlog let $a+3d$ this number and according to question- $a^2+(a+d)^2+(a+2d)^2=a+3d$ but I could not solve the above equation.", "Co-Buyer Automobile As a co-buyer on an automobile, can the other party take full possession? Both parties names are listed as the Purchaser's. Only one purchaser signed the retail order for the motor vehicle, and if so, how can one become a no co-buyer?", "Preventing console window from closing on Visual Studio C/C++ Console application", "How to hide the [@] in a Minecraft command block", "A relative managed to change her password, yet can not input the correct password. She does not want to reset the phone to avoid loss of data (pictures, contacts, messages, etc.). Will the phone eventually stop accepting logon attempts?", "Install suspension forks on non-suspension bike I have a 1990s Saracen PowerTrax. Is there a way I can install a suspension fork, or will that muck up the bike somehow? I'm actually interested in ways to raise the bars with respect to the seat, so that wouldn't be a problem. My toes rubbing in the wheel, in the other hand, would definitely be a problem.", "The weighted sum of two independent Poisson random variables Using wikipedia I found a way to calculate the probability mass function resulting from the sum of two Poisson random variables. However, I think that the approach I have is wrong. Let $X_1, X_2$ be two independent Poisson random variables with mean $\\lambda_1, \\lambda_2$, and $S_2 = a_1 X_1+a_2 X_2$, where the $a_1$ and $a_2$ are constants, then the probability-generating function of $S_2$ is given by $$ G_{S_2}(z) = \\operatorname{E}(z^{S_2})= \\operatorname{E}(z^{a_1 X_1+a_2 X_2}) G_{X_1}(z^{a_1})G_{X_2}(z^{a_2}). $$ Now, using the fact that the probability-generating function for a Poisson random variable is $G_{X_i}(z) = \\textrm{e}^{\\lambda_i(z - 1)}$, we can write the probability-generating function of the sum of the two independent Poisson random variables as $$ \\begin{aligned} G_{S_2}(z) &amp;= \\textrm{e}^{\\lambda_1(z^{a_1} - 1)}\\textrm{e}^{\\lambda_2(z^{a_2} - 1)} \\\\ &amp;= \\textrm{e}^{\\lambda_1(z^{a_1} - 1)+\\lambda_2(z^{a_2} - 1)}. \\end{aligned} $$ It seems that the probability mass function of $S_2$ is recovered by taking derivatives of $G_{S_2}(z)$ $\\operatorname{Pr}(S_2 = k) = \\frac{G_{S_2}^{(k)}(0)}{k!}$, where $G_{S_2}^{(k)} = \\frac{d^k G_{S_2}(z)}{ d z^k}$. Is this is correct? I have the feeling I cannot just take the derivative to obtain the probability mass function, because of the constants $a_1$ and $a_2$. Is this right? Is there an alternative approach? If this is correct can I now obtain an approximation of the cumulative distribution by truncating the infinite sum over all k?", "Extend a language with additional keywords?", "I am working in Illustrator (15.0.2 (CS5) or 16.0.0 (CS6)) and when I try to move objects small distances, they snap to the nearest two pixels on some invisible grid. I can't find anything in the preferences. Here are some screen shots:", "I am studying for an exam and I am having trouble with this practice question: In this question, we consider finite bit strings that do not contain $00$. Examples of such bitstrings are $0101010101$ and $11110111$. For any integer $n\\geq 2$, let $B_n$ be the number of bitstrings of length $n$ that do not contain $00$. Determine $B_2$ and $B_3$. Prove that $B_n = B_{n-1} + B_{n-2}$ for each $n\\geq 4$. For each $n\\geq 2$, express $B_n$ in terms of a Fibonacci number. Any help is greatly appreciated", "Nobody owner (99 99) in FTP caused by php functions?" ]

[ "Let $(a_n)$ be a sequence of positive terms and suppose that $\\sum_\\limits{n=0}^{\\infty} a_n$ converges. Show that $\\sum_\\limits{n=0}^{\\infty} a_n^2$ converges. This is in the section on the Comparison Test so that must be what I'm supposed to use. But I don't see how. $(a_n)^2$ might be smaller or larger than $a_n$ depending on $a_n$. And I can't use the Comparison Test with some other series because there's no info here about how fast $\\sum a_n$ converges. Hmm. Any hints?", ". The has no sign of the user sharth The also does not have any sign of related activity I would like to know why the user's name is associated with the question. At least why their display name shows up as having modified the question timeline activity. Possible reason that I can think of is that, . Is this the reason? Is there a way (for normal users), to look for such details, other than looking at the user activity and the question's revision history.", "What is the correct name for a \"product function\" on a monoid?", "SQL Server: Examples of PIVOTing String data", "I am a newbie in linux. I wanted to install ubuntu to my desktop. I currently have two partitions, Windows 8 in installed on one, and i have some important files in another partition. While installing ubuntu, if I chose \"Replace Windows 8 with Ubuntu\", do I lose the other partition too? And are there other ways to leave the other partition as it is, and install ubuntu in the partition where windows was installed.", "Bad Character code (256)/ \\select@language{greek}", "I want to have a video background that will loop on some frames of my presentation. Can anyone help me to do that?", "Derivation of binomial coefficient in binomial theorem. How was the binomial coefficient of the binomial theorem derived? $$\\frac{n!}{k!(n-k)!}$$", "Extension “RANDR” missing on xvfb My system: $lsb_release -a No LSB modules are available. Distributor ID: Ubuntu Description: Ubuntu 14.04.3 LTS Release: 14.04 Codename: trusty Xvfb: $ dpkg -s xvfb Package: xvfb Status: install ok installed Priority: optional Section: x11 Installed-Size: 2140 Maintainer: Ubuntu X-SWAT &lt;ubuntu-x@lists.ubuntu.com&gt; Architecture: amd64 Multi-Arch: foreign Source: xorg-server Version: 2:1.15.1-0ubuntu2.7 Provides: xserver Current problem: Xvfb do not support RANDR extension, even if I add the flag: +extension RANDR If I run xdpyinfo, RANDR is not on the list. It's a missing feature or a bug. I found a reference here with a patch: And looks like that in other distros like debian, there is already a testing build of Xvfb with support: I am trying to run a program throught Xvfb, and it returns the following error: Xlib: extension \"RANDR\" missing on display \":99\". The program works if I run it via ssh/command line. The problem appears to be the the lack of support for \"RANDR\" in xvfb. My question is: what is the easiest way to get xvfb with \"RANDR\" support in my system?", "Finding $\\int^{\\infty}_{0}\\frac{\\ln^2(x)}{(1-x^2)^2} dx$", "I'm setting up an online ordering system but I'm in Australia and for international customers I'd like to show prices in US dollars or Euros so they don't have to make the mental effort to convert from Australian dollars. Does anyone know if I can pull up to date exchange rates off the net somewhere in an easy-to-parse format I can access from my PHP script ? UPDATE: I have now written a PHP class which implements this. .", "Usage and origin of \"sister\" in expressions like \"sister company, sister ship, sister site\" etc The term is often used figuratively to refer, for instance, to a “sister company” for a company within the same group, or to a “sister site” for sites that belong to the same family. This connotation as explained by the means: belonging to a pair or group of similar and related things, such as businesses, usually owned or operated by the same person or organization: our sister company in Australia. also, from : You can use sister to describe something that is of the same type or is connected in some way to another thing you have mentioned. ⇒ ...the International Monetary Fund and its sister organisation, the World Bank. ⇒ ...Voyager 2 and its sister ship, Voyager 1. This usage appears to be common with things that are regarded as feminine and are associated, as if by kinship, with other similar things that belong to the same group. An early usage example of this is the \"sister\" referred to ships: the US battleship Missouri and her sister ship, the Wisconsin. In other instances, the \"feminine\" issue is less explicit as in the case of internet sites, so I guess this usage has to do with the fact that English is less gender specific when it comes to things or abstract entities. Questions: Does “sister” apply to whatever entity that belongs to the same group irrespective of its real or perceived gender? or could \"brother\" be used instead? Where does this usage come from?", "I want to determine the set of natural numbers that can be expressed as the sum of some non-negative number of 3s and 5s. $$S=\\{3k+5j∣k,j∈\\mathbb{N}∪\\{0\\}\\}$$ I want to check whether that would be: 0,3, 5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, and so on. Meaning that it would include 0, 3, 5, 8. Then from 9 and on, every Natural Number. But how would I explain it as a set? or prove that these are the numbers in the set?", "Breitbart today: What is the source for the term nothing-burger?", "Well, luckily I got this error on my test environment. I'm so scared about this error that I disabled all logon triggers I was using on production environment. I created the famous logon trigger, and I put a database in offline mode just to mess with something else. Then I discover that because the trigger can't find the table, I can't access the instance anymore. There are plenty of questions related to this, but even doing everything I could find, I still can't acces the instance, not even with SQLCMD. I'm doing this: sqlcmd -S server\\instance -U sa -P &lt;pass&gt; -A If I don't use -A I receive the famous error: logon failed for sa due trigger execution. If I use -A: Sqlcmd: Error: Microsoft ODBC Driver 11 for SQL Server : SQL Server Network Interfaces: An error occurred while obtaining the dedicated administrator connection (DAC) port. Make sure that SQL Browser is running, or check the error log for the port number [xFFFFFFFF]. . Sqlcmd: Error: Microsoft ODBC Driver 11 for SQL Server : Login timeout expired. Sqlcmd: Error: Microsoft ODBC Driver 11 for SQL Server : A network-related or instance-specific error has occurred while establishing a connection to SQL Server. Server is not found or not accessible. Check if instance name is correct and if SQL Server is configured to allow remote connections. For more information see SQL Server Books Online.. Why i'm not able to connect to the sql server sql server express here. I could enable SQL Browser, but I still can't access it. I don't think this question is duplicated because is not about the trigger, is about Why I can't access the server with SQLCMD. I pretty much know how to fix this. I just don't know how can I acces sql server without triggering the trigger.", "I am afraid that listing doesn't support javascript. \\begin{lstlisting}[language=javascript] ... \\end{lstlisting} What am I doing wrong?", "How to programmatically remove a field from a node?", "Uniform convergence of $\\sum (-1)^nf_n(x)$ on $[0,1]$ where $f_n(x)=x^n(1-x)$. Let $f_n(x) = x^n(1-x)$ and $\\sum (-1)^nf_n(x)$. I showed that this series point wise. Case1) $x=1$ $$ f_n(1)=0 \\, , \\sum{(-1)^nf_n(1)} = 0 $$ Case2) $x\\neq 1$ $$|f_n(x)| \\leq |x|^n$$ since $$\\sum |x|^n$$ converges, By abosultely convergese test $\\sum (-1)f_n(x)$ converges. I want to show that this series uniformly converges on $[0,1]$.", "mysql database no space available", "Could it be that Goldbach conjecture is undecidable? The result closest to Goldbach conjecture is Chen's theorem [Sci. Sinica 16 157–176], the proposition ``1+2''. It is natural to ask if it is likely that under our arithmetic axioms the Goldbach conjecture is an undecidable proposition." ]

[ "Making overview with linked detailed maps in QGIS?", "I have this weird object (vascular tree) which is empty inside, but closed from the top and the bottom: However, it is empty inside, which makes me unable to use boolean on a bigger object (I want to make a hole in an object through which this object will go through). So I thought I should fill it and then try to boolean. But, how do I fill it? Thank you sincerely.", "Probability of selecting an even natural number from the set $\\Bbb N$. I confirmed on thread that there are as many as even natural numbers as there are natural numbers. Question : Suppose I have selected a number $n \\in \\mathbb N$; what is the probability that $n$ is even? My Thought : $\\text{Probability} = \\dfrac{\\text{n(E)}}{\\text{n(S)}}$ Here $\\text{n(S)}$ is the set of all natural numbers i.e. $\\mathbb N$, and $\\text{n(E)}$ is set of all even natural numbers. Since it is proved that number of elements is the set $\\mathbb N$ is exactly the same as the number of elements in the set of natural numbers (it’s very easy to put the set of natural numbers, $\\Bbb N=\\{0,1,2,3,\\dots\\}$, into one-to-one correspondence with the set $\\text{E}=\\{0,2,4,6,\\dots\\}$ of even natural numbers; the map $\\Bbb N\\to \\text{E}:n\\mapsto 2n$ is clearly a bijection.) ; Thus, Probability $= \\boxed 1$ I know this is definitely wrong.Probability must be $0.5$. But where am I wrong? Can anyone explain ? Thanks!", "How can I change the registered name in Windows 7 to my own? how do I change the registered name in Windows 7 to my own name?", "Mann-Whitney U test with unequal sample sizes", "How To Auto-Format / Indent XML/HTML in Notepad++", "I can't create more than 4 partitions", "How To Recover My Data From Not Detected Hard Disk? I am using Acer Laptop one day before my Hard Disk is not detected in BIOS and not booting it's shows Insert Boot Disk and I am try another H.D.D it's boot perfectly in my Laptop but,I want detect and recover my data on not detected hard disk. I am not experience about Hard Disk please, can any one help me how to recover my data from not detected Hard Disk.", "How do I add a repository from behind a proxy? I've a problem at the office. We're behind a proxy (which is set and applied at ubuntu proxy settings) and when I try to add a repository from terminal, I get: Error reading --some url here--: urlopen error [Errno 113] No route to host I've tried with Launchpad-getkeys script. I get this (image) I've tried with another \"hack\", without luck Press Alt-F2 and type gksu gedit /usr/lib/python2.6/dist-packages/softwareproperties/ppa.py Find line 88, change keyserver.ubuntu.com to hkp://keyserver.ubuntu.com:80 Save, close and reboot. Does anyone know if I could solve this problem in any way? Thanks", "I am confused with the definition of non-parametric model after reading this link and . Originally I thought \"parametric vs non-parametric\" means if we have distribution assumptions on the model (similar to parametric or non-parametric hypothesis testing). But both of the resources claim \"parametric vs non-parametric\" can be determined by if number of parameters in the model is depending on number of rows in the data matrix. For kernel density estimation (non-parametric) such a definition can be applied. But under this definition how can a neural network be a non-parametric model, as the number of parameters in the model is depending on the neural network structure and not on the number of rows in the data matrix? What exactly is the difference between parametric and a non-parametric model?", "subsurf splits the mirrored model into two objects I tried to subsurf this model that I mirrored but when I use subsurf it splits the model into two objects. Before Subsurf: After Subsurf: Any help would be appreciated.", "How exactly does a \"random effects model\" in econometrics relate to mixed models outside of econometrics? I used to think that \"random effects model\" in econometrics corresponds to a \"mixed model with random intercept\" outside of econometrics, but now I am not sure. Does it? Econometrics uses terms like \"fixed effects\" and \"random effects\" somewhat differently from the literature on mixed models, and this causes a notorious confusion. Let us consider a simple situation where $y$ linearly depends on $x$ but with a different intercept in different groups of measurements: $$y_{it} = \\beta x_{it} + u_i + \\epsilon_{it}.$$ Here each unit/group $i$ is observed at different timepoints $t$. Econometricians call it \"panel data\". In mixed models terminology, we can treat $u_i$ as a fixed effect or as a random effect (in this case, it's random intercept). Treating it as fixed means fitting $\\hat \\beta$ and $\\hat u_i$ to minimize squared error (i.e. running OLS regression with dummy group variables). Treating it as random means that we additionally assume that $u_i\\sim\\mathcal N(u_0,\\sigma^2_u)$ and use maximum likelihood to fit $u_0$ and $\\sigma^2_u$ instead of fitting each $u_i$ on its own. This leads to the \"partial pooling\" effect, where the estimates $\\hat u_i$ get shrunk toward their mean $\\hat u_0$. R formula when treating group as fixed: y ~ x + group R formula when treating group as random: y ~ x + (1|group) In econometrics terminology, we can treat this whole model as a fixed effects model or as a random effects model. The first option is equivalent to the fixed effect above (but econometrics has its own way of estimating $\\beta$ in this case, called \"within\" estimator). I used to think that the second option is equivalent to the random effect above; e.g. @JiebiaoWang in his highly upvoted answer to says that In econometrics, the random-effects model may only refer to random intercept model as in biostatistics Okay --- let us test if this understanding is correct. Here is some random data generated by @ChristophHanck in his answer to (I put for those who do not use R): @Christoph does two fits using econometrics approaches: fe &lt;- plm(stackY~stackX, data = paneldata, model = \"within\") re &lt;- plm(stackY~stackX, data = paneldata, model = \"random\") The first one yields the estimate of beta equal to -1.0451, the second one 0.77031 (yes, positive!). I tried to reproduce it with lm and lmer: l1 = lm(stackY ~ stackX + as.factor(unit), data = paneldata) l2 = lmer(stackY ~ stackX + (1|as.factor(unit)), data = paneldata) The first one yields -1.045 in perfect agreement with the within estimator above. Cool. But the second yields -1.026, which is miles away from the random effects estimator. Heh? What is going on? In fact, what is plm even doing, when called with model = \"random\"? Whatever it is doing, can one somehow understand it via the mixed models perspective? And what is the intuition behind whatever it is doing? I read in a couple of econometrics places that random effects estimator is a weighted average between the fixed effects estimator and the \"between\" estimator which is more or less regression slope if we do not include group identity in the model at all (this estimate is strongly positive in this case, around 4.) E.g. @Andy : The random effects estimator then uses a matrix weighted average of the within and between variation of your data. [...] This makes random effects more efficient[.] Why? Why would we want this weighted average? And in particular, why would we want it instead of running a mixed model?", "I'm using Drupal seven. I want to make the options in a select list be dependent on the value chosen in another select list in a form. I'm sure this has been asked many times before, but I am having difficulty finding a clear answer for how to do this. The form is for users to enter a work history. They need to select a squadron which is a node reference to the squadron field type, and this is in a drop-down list. However, the squadron, is dependent upon a city drop-down list. Users first need to select a city which will then filter the options for the squadron. In the squadron content type, I created a taxonomy for city which gets tagged to the squadron. I would be very grateful for any pointers as to the best way (simplest?) to go about this, or for any useful resources online which would help.", "Show that all horses are of the same color. Im trying to understand the solution about this, and all the other solutions are.. a bit weird for me and dont answer all my questions! Reference : Im using the answer there as reference, but my understanding is a bit different! Find the error in the following proof that all horses are the same color. CLAIM: In any set of h horses, all horses are the same color. PROOF: By induction on h. Basis: For h = 1. In any set containing just one horse, all horses clearly are the same color. Induction step: For k > I assume that the claim is true for h = k and prove that it is true for h = k + 1. Take any set H of k + 1 horses. We show that all the horses in this set are the same color. Remove one horse from this set to obtain the set H1 with just k horses. By the induction hypothesis, all the horses in H, are the same color. Now replace the removed horse and remove a different one to obtain the set H2 . By the same argument, all the horses in H2 are the same color. Therefore all the horses in H must be the same color, and the proof is complete. Here's what i have come up with : Suppose a set of 1 horse. $H_a = { horse_{1} }$ Obviously, all the horses in set $H_a$ are the same, since theres just 1 horse. So using that as the Basis of the induction we can proceed and try to prove its true for $N$ horses. -- I dont fully understand the part below As an example : set $H_0$ : $H_0 = { horse_{1}, horse_{2}, horse_{3}... horse_{n} }$ In my understanding, its because, I can make a subset formed by 1 horse : $K_1 = {horse_{1}}$ $K_2 = {horse_{2}}$ ... I don't get it. I clearly know that this proof is a lie. And for me, its because you cant claim theres a relation on a set with size $&gt;= 2$ , since : $H_1 = { horse_{1}, horse_{2}}$ Theres nothing that says $horse_{1}$ equals $horse_{2}$. The basis was for one horse. But that alone is not a proof. So what should I do ?", "Aiming at specific body parts My players have been asking to improvise specific combat actions, mostly the archer wanting to aim at specific body parts. I haven't been able to find anything in the DMG or the PHB on the subject so I was wondering how I should deal with this. How (if at all) should an attack roll be modified when targeting a specific body part? If there is not RAW on this I am open to playtested house rules per .", "Where do you go for the 'nearest railroad' in Monopoly? In the American edition of Monopoly, there is a Chance card that says: Advance token to nearest railroad Pay owner twice the rental to which he/she is entitled. If railroad is unowned, you may buy it from the bank. However, is this the closest railroad, or the next one? If you are standing on the Chance spot in the light blues, do you go all around the board to Reading, which is the closest to you, or do you go to Pennsylvania, which is the first one you land on?", "Remove a marker from a GoogleMap", "Can you explain briefly the main concepts and command line tools used to manage file permissions?", "What does the register keyword do in C language? I have read that it is used for optimizing but is not clearly defined in any standard. Is it still relevant and if so, when would you use it?", "Why is it bad to log in as root? I've often come across posts on forums or other websites where you see people joking in such a manner about running/logging in as root as if it's something awful and everyone ought to know about it. However, there isn't much that a search reveals on the matter. It may be widely known to Linux experts, but I really don't know why. I remember always running as root when I first tried Linux years ago (Redhat and Mandrake) and don't remember running into any problems because of that. There are actually some distros that have a bright red background with alert signs all over it as wallpaper for the root user (SuSe?). I still use the \"Administrator\" account for regular use on my Windows installation and haven't ever run into any problems there either." ]

[ "Polygamma reflection formula", "Why does $x$ divided by zero not equal $x$? After all, $x$ is not being divided by anything.", "I am being flown out by a company for an on-site visit. Will I earn miles for this trip, or will the company?", "I need to evaluate the limit without using l'Hopital's rule. $$\\lim_{x \\to 0}{\\frac{\\sqrt{1+x\\sin{x}}-\\sqrt{\\cos{2x}}}{\\tan^{2}{\\frac{x}{2}}}}$$", "Custom function won't refresh as inputs are changed", "Why do a lot of questions from around 2008 seem to have really high upvotes?", "Silencing \"Your disk is almost full\" notification", "I don't know how many of you have experienced the principle when posting questions on SO, but I know I have on a few occasions. And then I just discard my question. So here's the question: Should we go ahead and post the question? Of course if it's something stupid like forgetting a semicolon, etc., I would say no... but there are several occasions, like if a data structure doesn't make sense, that at least someone would eventually benefit from the question/answers. And if you should ask the question, how would you recommend choosing an answer for it?", "I have made a raster elevation map of Greenland, and have information of the region, cities and more as vectors. The information is not in the same place as my elevation map. I have selected EPSG:5938 on the bottom right in QGIS and on my informations and elevation map I have set the CRS to the same like the picture How do I get it all on the same position?", "Why am I forced to use the newest chat interface? When logging into chat-stackexange I am presented with this message: The new mobile version of chat is now the default mobile version on devices that support it. Unlike the classic (okay, ancient) version, it allows you to perform actions like editing, starring, and direct replies to particular messages. The classic version is still available and will be used in browsers that lack support for some necessary features of the new version. Logged in users can also choose to continue using the old version on the preferences page of their user profile. Please report bugs and other issues on Meta Stack Exchange. Thank you! I choose to continue using the old version but cannot find the option to do so on my chat user profile page?", "Rm can't delete file", "How to get back Windows 10 [UEFI] after Legacy installation of Fedora 24?", "Is there any well-ordered uncountable set of real numbers under the original ordering? I know that the usual ordering of $\\mathbb R$ is not a well-ordering but is there an uncountable $S\\subset \\mathbb R$ such that S is well-ordered by $&lt;_\\mathbb R$? Intuitively I'd say there is no such set but intuitively I'd also say there is no well-ordered uncountable set at all, which is obviously wrong. I still struggle to grasp the idea of an uncountable, well-ordered set.", "How do you document your databases? I find that most of my clients are not documenting their databases at all and I find that pretty scary. To introduce some better practice, I would like to know what tools/process people are using. How do you document your database? (SQL-Server) What tool do you use? Documentation Storage Format for database schema/meta-data? Word documents Excel spreadsheet Plain Text Documentation process or policies? I am not talking about reverse engineering / document a existing database, but mainly on the documentation best practices while you develop your system/database.", "Travelling as an unmarried Western couple in Indonesia", "How can I get crash data (stack traces at least) from my Android application? At least when working on my own device being retrieved by cable, but ideally from any instance of my application running on the wild so that I can improve it and make it more solid.", "How do I filter out addresses using HTTPS for a D-Link router? I recently got a new router, a DRL-600L Router from D-Link, and was setting up some filters to block out certain websites. One problem I am having is blocking out addresses that use https instead of http. For example, I'm trying to block out Facebook, because Facebook. So far, the filter filters http://www.facebook.com perfectly fine, but for the url https://www.facebook.com, it won't block that. How can I block those kinds of websites?", "Java string to date conversion", "How do I get a Seraph Crystal?", "I see the following error while trying run the command shown below. I read somewhere that my /boot partition is low on disk space. How can I increase the size of the /boot partition so I can install more software? I have a 500GB hard disk, so there is enough space to play with. sudo apt-get install libdvdread4 gzip: stdout: No space left on device E: mkinitramfs failure cpio 141 gzip 1 update-initramfs: failed for /boot/initrd.img-3.2.0-33-generic with 1. run-parts: /etc/kernel/postinst.d/initramfs-tools exited with return code 1 Failed to process /etc/kernel/postinst.d at /var/lib/dpkg/info/linux-image-3.2.0-33-generic.postinst line 1010. dpkg: error processing linux-image-3.2.0-33-generic (--configure): subprocess installed post-installation script returned error exit status 2 dpkg: dependency problems prevent configuration of linux-image-server: linux-image-server depends on linux-image-3.2.0-33-generic; however: Package linux-image-3.2.0-33-generic is not configured yet. dpkg: error processing linux-image-server (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-server: linux-server depends on linux-image-server (= 3.2.0.33.36); however: Package linux-image-server is not configured yet. dpkg: error processing linux-server (--configure): dependency problems - leaving unconfigured No apport report written because the error message indicates its a followup error from a previous failure. No apport report written because the error message indicates its a followup error from a previous failure. Errors were encountered while processing: linux-image-3.2.0-33-generic linux-image-server linux-server N: Ignoring file 'michael-gruz-canon-precise.list.1' in directory '/etc/apt/sources.list.d/' as it has an invalid filename extension N: Ignoring file 'michael-gruz-canon-precise.list.1' in directory '/etc/apt/sources.list.d/' as it has an invalid filename extension Listed below is the output of du Filesystem 1K-blocks Used Available Use% Mounted on /dev/mapper/ubuntu-root 712660664 104095912 572363692 16% / udev 3964792 4 3964788 1% /dev tmpfs 1591012 1064 1589948 1% /run none 5120 0 5120 0% /run/lock none 3977528 684 3976844 1% /run/shm /dev/sda1 233191 219821 929 100% /boot" ]

[ "Why does latex stretch small sections across the whole page vertically? I'm writing my bachelor-thesis and have a couple of small sub-sub-sections explaining conversions, like in the following \\subsubsection*{Assignment} This document only explains non-compound assignments. The other kind, i.e \\texttt{a += b}, is supported by the language too, but is not yet implemented. \\begin{itemize} \\item If the first is an \\texttt{auto} variable, no conversion takes place when assigning the right hand side to the variable designated by the left hand side. \\item Otherwise, an assignment conversion takes place converting the given value to the type of the designated variable. \\item Assignment requires an lvalue as the left hand side, and yields an lvalue result. \\end{itemize} \\subsubsection*{Multiplication} % ... But latex renders it quite ugly with much space in between the items. I think it does so to fit the whole page. How can I tell it not to do so? Is what I'm doing right at all?", "I have just finished my homework. I just finished my homework. I think there must be a difference in meaning. Could anyone tell me the difference in meaning sentence 1 and sentence 2?", "I write financial applications where I constantly battle the decision to use a double vs using a decimal. All of my math works on numbers with no more than 5 decimal places and are not larger than ~100,000. I have a feeling that all of these can be represented as doubles anyways without rounding error, but have never been sure. I would go ahead and make the switch from decimals to doubles for the obvious speed advantage, except that at the end of the day, I still use the ToString method to transmit prices to exchanges, and need to make sure it always outputs the number I expect. (89.99 instead of 89.99000000001) Questions: Is the speed advantage really as large as naive tests suggest? (~100 times) Is there a way to guarantee the output from ToString to be what I want? Is this assured by the fact that my number is always representable? UPDATE: I have to process ~ 10 billion price updates before my app can run, and I have implemented with decimal right now for the obvious protective reasons, but it takes ~3 hours just to turn on, doubles would dramatically reduce my turn on time. Is there a safe way to do it with doubles?", "How do I interpret the results of a regression which involves interaction terms? If I have a linear regression of the form: $$y \\sim 1+\\beta_1x_1 + \\beta_2x_1x_2,$$ where $x_2$ is a Boolean variable depending on another variable $x_{2cont}$, a positive variable: $$x_2 = \\begin{cases} 1 &amp; \\mbox{if } x_{2cont} &gt; 5 \\\\ 0 &amp; \\mbox{if } 0 &lt; x_{2cont} \\le 5. \\end{cases}$$ And I got regression results. How shall I interpret the regression results? esp. how shall I interpret the two coefficients I get from this regression, $\\beta_1 \\text{ and } \\beta_2$?", "I've been watching a lot of pro replays ever since the SC2 beta came out, and I've noticed that almost always, when Protoss research upgrades, the shields are the last research chosen. Why is that? Seems to me that if anything, shields should be the most important upgrade, as they affect all Protoss units and buildings.", "Why can't I log into minecraft with a mojang account? I created a Mojang account and downloaded the Minecraft launcher, but when I started it up, I couldn't log in. Since the log in fields did not require a username, I tried typing in my email, and still couldn't log in. I've tried after resetting my password, but that didn't work either. What am I supposed to do to log in and play?", "How can i render the reflections i see in the Look Dev viewport in Blender 2.8 i'm finding blender 2.8 confusing and i'm relatively new to blender in general anyway. While looking at my model in the Look Dev view port i can see reflections. However, when i render my scene in eevee (and cycles), the reflections aren't rendered Is there something i'm doing wrong or an option i haven't enabled?", "Waiting for user input with a timeout I have searched but apparently my google foo is weak. What I need is a way to prompt for user input in the console and have the request time out after a period of time and continue executing the script if no input comes in. As near as I can tell, Read-Host does not provide this functionality. Neither does $host.UI.PromptForChoice() nor does $host.UI.RawUI.ReadKey(). Thanks in advance for any pointers. EDIT: Much thanks to Lars Truijens for finding the answer. I have taken the code that he pointed out and encapsulated it into a function. Note that the way that I have implemented it means there could be up to one second of delay between when the user hits a key and when script execution continues. function Pause-Host { param( $Delay = 1 ) $counter = 0; While(!$host.UI.RawUI.KeyAvailable -and ($counter++ -lt $Delay)) { [Threading.Thread]::Sleep(1000) } }", "PHPExcel Sumif and Skip", "How can I dynamically invoke a class method in PHP? The class method is not static. It appears that call_user_func(...) only works with static functions? Thanks.", "What is the differance between Linked and Appended data from external .blend files?", "Basic question, how do I resume interrupted / failed downloads in Firefox?", "iPhone 5S, LTE does not work", "How to embed a text file in a .NET assembly? I would like to embed a text file in an assembly so that I can load the text without having to read it from disk, and so that everything I need is contained within the exe. (So that it's more portable) Is there a way to do this? I assume something with the resource files? And if you can, how do you do it and how do you programaticaly load the text into a string?", "Is the cube root of a prime number rational?", "I think this is just something I've grown used to but can't remember any proof. When differentiating and integrating with trigonometric functions, we require angles to be taken in radians. Why does it work then and only then?", "How can I make Ubuntu 18.04 / 18.10 desktop use Unity (be like Ubuntu 14.04)?", "Can you grapple/shove with the Hunter Ranger's Whirlwind Attack?", "Where to get school zone shapefiles? Census.gov usually makes available the shapefiles containing school zone boundaries. Due to the US government shutdown, census.gov is down. Does anyone know where to download a recently archived copy?", "Why is there no overload of Interlocked.Add that accepts Doubles as parameters?" ]

[ "In the decimal system: $...-3, -2, -1, 0, 1, 2, 3...$ In the binary system: $...-11, -10, -1, 0, 1, 10, 11...$ In the unary system: $-111, -11, -1, \\text{ ??? }, 1, 11, 111...$ I was only able to find a related question but none with an answer so far:", "Create a trigger on all the last_modified columns in PostgreSQL In PostgreSQL 9.5, I have tables with columns in the form prefix_last_modified timestamp without time zone NOT NULL DEFAULT (clock_timestamp() AT TIME ZONE 'UTC') I was looking for a way to set the last modified value automatically updated at each update of the rows, and I found that defined the function: CREATE OR REPLACE FUNCTION update_modified_column() RETURNS TRIGGER AS $$ BEGIN NEW.modified = now(); RETURN NEW; END; $$ language 'plpgsql'; Now, I'd like to know if there is any way to pass the column name to the PostgreSQL function and to execute it to the NEW row? E.g. CREATE OR REPLACE FUNCTION update_modified_column(varchar column) RETURNS TRIGGER AS $$ BEGIN NEW.column = now(); RETURN NEW; END; $$ language 'plpgsql';", "Always when I'm going to travel to someplace, I book my hostel with precedence. Actually I look only for two Booking sites: Is there a cheaper site than these two, which has the same service with same quality, with the same number or larger?", "Ubuntu boots from USB but get GRUB rescue after installation I can boot Ubuntu from USB, but when I took the USB stick out of the laptop and booted again, I got an error saying Error: unknown filesystem. grub rescue&gt; What can I do to fix this?", "On the number divisors of a number Let $d(n)$ be the number divisors of a natural number $n$. Now let $m$ be a natural number. Find least natural number $n$ such that $d(n)=m$. Thank you", "I have a Laars gas boiler that has 3 heating zones. I want to replace the old mercury honeywell tstat on the 1st floor (heat only) with a newer honeywell RTH9580 wifi model. I've taken pictures of my entire system, labeled the wires in the pics to indicate the associated connections, and included the Laars wiring diagram. There is a transformer mounted on the wall near the boiler that is wired in-line to the system (power from the panel --> into the emergency boiler switch --> into the wall transformer --> then to the boiler (low water cut off and boiler circuitry). There is also a transformer within the boiler circuitry itself. Can someone tell me the best method (proper preferred, not necessarily easiest) to connect the C wire?", "What is JavaScript's highest integer value that a number can go to without losing precision? Is this defined by the language? Is there a defined maximum? Is it different in different browsers?", "Why is homology invariant under deformation retraction/homotopy equivalence?", "The more I use Stack Exchange, the more it is getting a knowledge-base for me. All questions, that I need for later reference I mark as favorite. Now I need to store these pages locally on my laptop. It is really time-consuming: I could use Ctrl+S on each favorite question page on Linux: there could be a solution with wget -N -r -l 1 &quot;https://stackoverflow.com/users/1069083/rubo77?tab=favorites&quot; this will download all favorite questions but it creates no correct index.html Another approach would be to use the to automatically follow into all your Stack Exchange-accounts. But that would have to be somehow limited to only favorites links on your in each stack. cross-platform: You would need a firefox-plugin that downloads links recursively but only within the favorite-area of the in your stack Additionally, I would like to and", "What do I call the ′ in mathematical formulae? As in x′ = x + t \"Ex (?) equals ex plus tee\". In Russian it is called \"штрих\" (shtrikch).", "What are the minimum root filesystem applications that are required to fully boot linux?", "Is starting a group with 5 newbies (DM included) possible? Some friends and I want to start playing D&amp;D (5e), but none of us, DM included (not me) have played before to any great extent. The DM and I have some cursory experience with 4e, but have never been able to play to any great extent. Is this advisable, or should we play with existing groups first? We live in a relatively remote area, making it hard to find experienced players.", "How fast would someone have to run to run over water? I was thinking about Flash, the superhero, or the little boy in the Incredibles. There is that doesn't answer a lot. Especially, I don't think surface tension would help a lot for a human to run over water, I think one would have to build on the inertial effect of the water. There is one empirical approach based on figuring out the speed at which bare-footed water skiing is done, but I wasn't able to find a decent number. Still the difference may be that a hypothetical runner would have to propulse herself over the water, which may or may not make the thing more difficult. Hence, I raise the question here.", "Why MOSFET source is indicated with arrow ?", "\"At least one\" - singular or plural subject?", ". While the reasons for his doing this are not yet public, this is a real loss of a valuable service. Does anyone know of similar services available to the general public? Edit: is definitely relevant, but that approach is more appropriate for finding top journals rather than identifying bottom ones. I.e., following that method would probably exclude lots of valid, lower-tier journals. Are there any approaches to easily identifying a predatory publisher?", "Most commented post should be the first post in the blog WordPress default setting is, most recent post is the first post of the blog. But, I need to \"Most commented post should be the first post in the blog\". ( Categories page as well as home page)", "How can we change root password?", "Why doesn't my command work when aliased? I use ps -ef | grep catalina | grep -v grep to print the tomcat process running on the system: kshitiz 7099 1 0 May11 ? 00:02:29 /usr/lib/jvm/jdk1.8.0/bin/java -agentlib:jdwp=transport=dt_socket,suspend=y,address=localhost:38156 -Dcatalina.base=/home/kshitiz/Documents/workspaces/ggts/.metadata/.plugins/org.eclipse.wst.server.core/tmp1 -Dcatalina.home=/opt/tomcat-7.0.42 -Dwtp.deploy=/home/kshitiz/Documents/workspaces/ggts/.metadata/.plugins/org.eclipse.wst.server.core/tmp1/wtpwebapps -Djava.endorsed.dirs=/opt/tomcat-7.0.42/endorsed -Dfile.encoding=UTF-8 -classpath /opt/tomcat-7.0.42/bin/bootstrap.jar:/opt/tomcat-7.0.42/bin/tomcat-juli.jar:/usr/lib/jvm/jdk1.8.0/lib/tools.jar org.apache.catalina.startup.Bootstrap start Then I use ps -ef | grep catalina | grep -v grep | awk -F' ' '{print $2}' to extract the process id: 7099 But when I alias the whole command alias tomcat_id=\"ps -ef | grep catalina | grep -v grep | awk -F' ' '{print $2}'\" and use it via alias, it prints the whole text and awk doesn't seem to work. type tomcat_id gives: tomcat_id is aliased to `ps -ef | grep catalina | grep -v grep | awk -F' ' '{print }''", "How to delete a full stop on reference ending According to APA rules, after each reference there must the digital object identification (doi). I use JabRef as a reference manager and for some reason, if I put an article doi on its \"doi\" field, it won't show up after the build on my editor, but if I put the doi on its \"note\" field it shows up. However, it's adding a period after the note field. I need a way to have the reference without an ending period. Here's the LaTex document. I use TexPad as my editor. \\documentclass[12pt,a4paper,oneside]{report} \\usepackage[utf8]{inputenc} \\usepackage[portuguese, english]{babel} \\usepackage[T1]{fontenc} \\usepackage{amsmath} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage[sort, longnamesfirst]{natbib} \\usepackage[strings]{underscore} \\bibliographystyle{newapa} \\usepackage{sectsty} \\chapterfont{\\fontsize{14}{15}\\selectfont} \\sectionfont{\\fontsize{12}{15}\\selectfont} \\subsectionfont{\\fontsize{12}{15}\\selectfont} \\renewcommand\\bibsection{\\section*{Referências}} \\bibpunct[:\\ ]{(}{)}{;}{a}{,}{,} \\title{} \\date{} \\makeindex \\begin{document} \\cite{aldous-newviewsgrandparents-1995} \\bibliography{/Users/Ricardo/Documents/Ricardo/library2.bib} \\end{document} It produces this: Aldous, J. (1995). New views of grandparents in intergenera- tional context. Journal of Family Issues, 16(1), 104–122. doi: 10.1177/019251395016001006. I need that last period out. Thanks." ]

[ "This morning, I had eggs for breakfast, and I was looking at the pieces of broken shells and thought \"What is the surface area of this egg?\" The problem is that I have no real idea about how to find the surface area. I have learned formulas for circles, and I know the equation for an ellipse; however, I don't know how to apply that. The only idea I can think of is to put an egg on a sheet of paper and trace it, and then measure the outline drawn, and then try to find an equation for that ellipse and rotate that about the $x$-axis. Now, my problem is how I can find the equation of the ellipse from the graph, and will my tracing method really be the edge of the egg? Also, can I use the ? Will I have to use some techniques to solve the integral that are not covered in the ? There has to be a better method for finding the surface area. Please, help me understand how to find the surface area of an egg; i.e., how to use my mathematical knowledge for something other than passing exams.", "Program to create EMF that conserves transparency What open source tools allow for the creation of EMFs that conserve transparency in ArcMap? I tried VeryPDF and Any DWG to Image Converter, neither on actually gave me a vector file that provided transparency. Adobe Illustrator is a bit pricey when all I want to do is convert CAD blocks to vector symbols to use as ArcMap markers. Anyone know of a good software for this purpose?", "One of the pertinent questions about many body systems that causes me much wonder is why the solar system is so stable for billions of years. I came across the idea of \"resonance\" and albeit an useful concept, it hardly explains the long stability of the solar system. Normally an N body problem with inverse square mutual interaction is an example of a chaotic system. Is there any real progress about this stability issue?", "Why can current only flow in loops? In the following image: Why can't current flow across the following wire? It's a simple question, but I've kind off always wondered. Thanks!", "Subquery in SQL Server Compact Edition", "How to determine the current widget's parent container (sidebar widget id)", "Showing that $\\lnot Q \\lor (\\lnot Q \\land R) = \\lnot Q$ without a truth table I've done a truth table after reducing it to this and it seems to be equal to $\\neg Q$: $$\\lnot Q \\lor (\\lnot Q \\land R) = \\lnot Q$$ But when I try to show it without a truth table (with just transformations), I end up in a loop between that and: $$\\lnot Q \\land (\\lnot Q \\lor R)$$ Is there a way to show this is true without using a truth table? What am I missing?! Thanks in advance!", "What happens if you call erase() on a map element while iterating from begin to end? In the following code I loop through a map and test if an element needs to be erased. Is it safe to erase the element and keep iterating or do I need to collect the keys in another container and do a second loop to call the erase()? map&lt;string, SerialdMsg::SerialFunction_t&gt;::iterator pm_it; for (pm_it = port_map.begin(); pm_it != port_map.end(); pm_it++) { if (pm_it-&gt;second == delete_this_id) { port_map.erase(pm_it-&gt;first); } } UPDATE: Of course, I then which I didn't think would be related but answers my question.", "How do I get Power Armor training in Fallout New Vegas? I've found some power armor, but I can't use it yet without training. I assumed that the Brotherhood of Steel would train me, if they like me enough. I've completed the Brotherhood of Steel quest series for the overseer (the original one, I did not overthrow him), but I did not get any Power Armor training. What do I have to do to be able to wear Power Armor?", "What commands are there for horizontal spacing? I know that \\: in LaTeX produces a space when rendered. Are there any alternatives, because my LaTeX renderer doesn't support \\: (it renders it as text), and there is no help / FAQ that I can find.", "Gaming the system for Populist badges", "Why is $\\mathbb{E}[X] = 1 + \\sum^\\infty_{k=1}\\mathbb{P}(X > k)$ true? I'm working through a problem regarding expected values in Markov chains, and at some point it says: Recall from probability that if $X$ is a positive integer valued random variable, then $\\mathbb{E}[X] = 1 + \\sum^\\infty_{k=1}\\mathbb{P}(X &gt; k)$. I know that by definition $\\mathbb{E}[X] = \\sum_a a\\mathbb{P}(X = a)$, but I can't see how the above equality follows from this, nor am I sure if this is how to approach the problem.", "In Minecraft, is there any way to make tools indestructible (without using mods)? I want to make some tools indestructible (for an adventure map). Is it possible to do this using enchantments (or a command of some kind?)", "Do not allow giving minus one for new user questions I always see Stack Overflow users giving -1 to new users' questions. This is not how you welcome a new user to the community. A new user does not know the rules yet. I suggest that if one wants to give -1 to a new user, you prevent that and ask the downvoter to write a comment instead. new user = 2 first questions I see the credit rating on my question is now at -9? My question, is she not well formed or formatted? If you don't agree with the content of a question do you down-rate it? If an Ubuntu user asks a question that might not be reasonable, will you also down-rate it? No. You post an answer that will present your thinking and correct him? I think that is part of the problem. When you first go to a community like Facebook, and you don't know the faces, you don't feel like any of those people are your relations. Newbies exist here as well, especially in a professional community. First, welcome the new user in more appropriate way. And most importantly, force them to see/read how to post a good question.", "When installing an application, the application lists permissions that it needs to perform its functions. I am creating this list of the the system defined permissions and a description of what they mean. It is a community wiki so if new permissions are added in the future they can be added to this list.", "Getting hybrid graphics to work nvidia-prime GT650M I recently made the switch to Ubuntu. Everything on my laptop works fine except my hybrid graphics card. It is Intel graphics combined with Nvidia GeForce GT650M. I tried Bumblebee, but primusrun doesn't work (segmentation fault, core dumped) and optirun works with glxspheres64, but steam games look worse with optirun than with Intel graphics (e.g. Surgeon Simulator 2013 runs fine with Intel and hangs a lot with optirun) I tried Nvidia Prime, but it gives me a black screen on startup after install, so I can't do anything and have to power off my PC with the power button. I also tried nvidia-prime 0.5 on Ubuntu 14.04, and then I get 'low-graphics mode' and I can't get to Unity.", "Under what circumstances will a passive HDMI-to-VGA adapter work? I have bought a no-brand, passive HDMI Male to VGA Female adapter, to link up a PC with a more dated monitor. It did not work. After doing some reading, I have learned that buying such an adapter is often discouraged because in many cases it will not convert the signal from Digital to Analog, or the Motherboard/CPU on a specific computer might not be compatible with that particular adapter. So my question is: seeing how there are so many of these passive adapters on the market, are there circumstances under which they actually do suffice to connect an HDMI output to a VGA input? Or are they generally just a rip-off? Example of the kind of adapter I bought:", "Have we managed to make a perfect vacuum? Have we managed to make a device without any atom inside it on earth? I was reading about vacuum , and I found in the examples part that even on the best man made vacuum devices, there are still millions of \"molecules per $cm^3$\". So my other question here is, what are these molecules and what is the mass of them?", "How to store pipe ( | ) in a variable? The idea would be to use it as... a pipe in a command. For instance: say there's some kind of long path which has to be retyped again and again, followed by a pipe and a second program, i.e. \"directory1/directory2/direcotry3/file.dat | less -I \" I'd like that part to be stored in a variable, so it could be used like this: r=\"directory1/directory2/direcotry3 \\| less -I -p \" $ cat path1/path2/$r &lt;searchterm&gt; Instead, I get cat: invalid option -- I Try `cat --help' for more information. ... meaning the pipe clearly didn't work.", "Expected value of a non-negative random variable" ]

[ "Is there a modal command for MakeLowercase? Analog to question I've been wondering WHAT is to \\lowercase as \\bfseries is to \\textbf? (... and for uppercase, or \\MakeLowercase and MakeUppercase, etc., which also seem to be text-block commands as explained .) Is there a \"switch\"/\"declaration\"/\"modal command\" (what is the correct term here?, is there a difference between them?) that would allow one to turn something into lowercase/uppercase in the same way that one would use \\scshape for example, i.e., not as text-block command with the curly braces? Or how to create such a command? I couldn't find any clue on the forum.", "Set a polygon's normal's orientation as the objects local rotation orientation (if every polygon is an object)", "Should we host our own nameservers? This is a about whether to outsource DNS resolution for ones own domains I currently have my ISP providing DNS for my domain, but they impose limitations on adding records. Therefore, I am thinking about running my own DNS. Do you prefer to host your own DNS, or is it better to have your ISP do this? Are there alternatives which I can look into?", "Prove that $\\mathbb{Z}$ is not isomorphic to additive group of any vector space over any field.", "Harry Potter: Why 7? While rereading the entire Harry Potter series I noticed that the number 7 occurs quite often, for instance: Seven books Seven Horcruxes planned by Tom Riddle Seven Weasley kids Seven years at Hogwarts Seven Harry Potters Seven people in a Quidditch team Did J.K. Rowling ever mention why 7 was so important in Harry Potter?", "Showing that two definitions of $\\limsup$ are equivalent", "Identifying which part of a large document is being compiled", "I always thought with \"any\" I should use the plural, but on the internet I can find both: It can be found in any book. It can be found in any books Do you have any books? It can be said in any language. This can be understood by anyone. It has been used in any form. So, what's correct? Is there any rule?", "Bugged display in search using negation", "How can I remove duplicates in my .bash_history, preserving order? I really enjoying using control+r to recursively search my command history. I've found a few good options I like to use with it: # ignore duplicate commands, ignore commands starting with a space export HISTCONTROL=erasedups:ignorespace # keep the last 5000 entries export HISTSIZE=5000 # append to the history instead of overwriting (good for multiple connections) shopt -s histappend The only problem for me is that erasedups only erases sequential duplicates - so that with this string of commands: ls cd ~ ls The ls command will actually be recorded twice. I've thought about periodically running w/ cron: cat .bash_history | sort | uniq &gt; temp.txt mv temp.txt .bash_history This would achieve removing the duplicates, but unfortunately the order would not be preserved. If I don't sort the file first I don't believe uniq can work properly. How can I remove duplicates in my .bash_history, preserving order? Extra Credit: Are there any problems with overwriting the .bash_history file via a script? For example, if you remove an apache log file I think you need to send a nohup / reset signal with kill to have it flush it's connection to the file. If that is the case with the .bash_history file, perhaps I could somehow use ps to check and make sure there are no connected sessions before the filtering script is run?", "What is the fastest algorithm for finding the natural logarithm of a big number?", "File issues after importing Drupal site I recently tried to move my Drupal site to a new server using this page: . But now the style doesn't seem be loaded and more importantly I get this error on every page in the site (even on the frontpage): Warning: file_put_contents(temporary://filef76T9k): failed to open stream: &quot;DrupalTemporaryStreamWrapper::stream_open&quot; call failed in file_unmanaged_save_data() (line 1900 of /Library/Server/Web/Data/Sites/Default/drupal/includes/file.inc). The file could not be created. Any ideas what this could be about?", "SF Story about human adapting to alien environment This is a story that was read on BBC radio about thirty years ago, and this is about as right as I can remember it: The human pilot of a spacecraft is doing some reconnaissance on an alien planet. He crashes but survives. For some reason, no one will know where to look for him. He sees something in the distance that looks like a building of some sort. When he gets there, it seems to be a home. Very much like a human home. There's furniture, but it's strange and uncomfortable . There's food, but it's inedible. There's a faucet but what comes out of it seems more like acid. Everything looks as though it should be right, but it's not. He leaves the house, wanders and after a few days is desperate for water. But there isn't any water anywhere. He's close to death, crawling on the ground and then something happens. There are cracks in the soil and there appears to be water bubbling up from perhaps some underground stream. The water revives him. He goes back to the house and tries the food again. It's delicious and he eats enough to gain back his strength. Then he decides to try the water again. It's pure and wonderful. He takes a shower and the last line of the story is how refreshing the water is on his skin and something about him lifting his tail.", "Why don't metals bond when touched together?", "SyntaxError: invalid syntax // SyntaxError: unexpected EOF while parsing How do I detect text inside of this, this is HTML &amp; this is XPath. I tried HTML &lt;span class=\"messageText\"&gt;Hello.&lt;/span&gt; XPath //*[@id=\"liveAgentChatLogText\"]/span[22]/span[2] I tried with this but it didn't work, it said no such element found. driver.find_element(By.XPATH, '//*[@id=\"liveAgentChatLogText\"]//*[contains(string(.), \"Hello\")]')", "Linear regression not fitting well I do a linear regression using R lm function: x = log(errors) plot(x,y) lm.result = lm(formula = y ~ x) abline(lm.result, col=\"blue\") # showing the \"fit\" in blue but it does not fit well. Unfortunately I can't make sense of the manual. Can someone point me in the right direction to fit this better? By fitting I mean I want to minimize the Root Mean Squared Error (RMSE). Edit: I have posted a related question (it's the same problem) here: and the raw data here: except that on that x is what is called errors on the present page here, and there are less samples (1000 vs 3000 in the present page plot). I wanted to make things simpler in the other question.", "Does \"Root A\" follow the fact about Takatsuki and the One-Eyed Owl? In Root A, Takatsuki does seem to be fascinated by Kaneki's name, but, I didn't at all expect her to be the One-Eyed Owl. I just looked her up on the and it says that she is the One Eyed-Owl as well as the horror novelist. Is this true only in the manga or is it also true in Root A?", "I am trying to prove the existence of the square root of $2$. I have some steps with a very vague explanation and I would like to clarify. The proof: Let $$S=\\{x\\in\\mathbb R\\mid x\\geqslant 0 \\text{ and } x^2&lt;2\\}.$$ I understand the proof of LUB, ∝ and so I am at the step where $\\alpha^2=2$. I know that we are to prove by contradiction so we state let $\\alpha^2 &lt;2$ and $\\alpha^2 &gt;2$. Now my instructor wants us to use the Archimedean Axiom $1/n = \\varepsilon$. $(\\alpha^2 + 1/n)^2$ then what.....", "A comparison between the verbs (come in / by), (drop in / by), (check in / by) (step in / by) and come over", "If dark matter only interacts with gravity, why doesn't it all clump together in a single point? I'm a complete layperson. As I understand, dark matter theoretically only interacts with the gravitational force, and doesn't interact with the other three fundamental forces: weak nuclear force, strong nuclear force, and electromagnetism. Those are my understandings going in. If I'm wrong, please correct me. I've done some googling, and I haven't found anything confirming or denying that dark matter is affected by either of the fundamental nuclear forces. So since dark matter only interacts with gravity, what causes any dark matter particle to be repelled from another? If they can pass freely through each other, and they are gravitationaly attracted to each other, why don't such particles clump together in a single 'point' in space? It seems to me that particles occupying a single 'space' are philosophically not distinct particles, but I don't know how actual physics would play into this. Edit , author's credentials unknown, but implicitly claims to be a physicist or astronomer, says \"...[P]hysicists generally take all dark matter to be composed of a single type of particle that essentially interacts only through gravity.\" Edit 2 The author is this , \"Professor of Science on the physics faculty of Harvard University.\"" ]

[ "override at runtime __setattr__", "I struggled with this over the weekend, and need to remap my mouse buttons.", "Finding all homomorphisms between $\\mathbb{Z}/m\\mathbb{Z}$ and $\\mathbb{Z}/n\\mathbb{Z}$ I want to find all group homomorphisms $\\varphi: \\mathbb{Z}/ m \\mathbb{Z} \\to \\mathbb{Z}/n\\mathbb{Z}$, with $m$ and $n$ natural numbers. Clearly $\\varphi(0)=0$ since the identity in $\\mathbb{Z}/m\\mathbb{Z}$ must map to the identity in $\\mathbb{Z}/n\\mathbb{Z}$, and it follows that $m \\varphi(1)=0$, so is $mx \\equiv 0 \\bmod n$? This as far as I get. How can I find all the homomorphisms?", "Two icons on Unity Launcher on non-standard application launch I have an application which doesn't come from any Ubuntu repo (neither official, nor PPA) but available as tgz and supposed to be unpacked and ready to use. To be precise it is . The problem is the application when launched shows its own icon in Unity Launcher. After making a custom .desktop file and placing shortcut onto Unity Launcher (by dragging from the dash) and launching it I see two icons - one placed by me and another one with real application. This is the .desktop contents: [Desktop Entry] Version=1.0 Type=Application Terminal=false Exec=/opt/LightTable/LightTable Name=Light Table Icon=/opt/LightTable/core/img/lticon.png One more thing. The /opt/LightTable/LightTable is bash script file and eventually /opt/LightTable/ltbin is being launched. I think this is the problem but have no idea how to fix the problem.", "How can I remove whitespace when declaring an XSL variable?", "Process substitution and pipe I was wondering how to understand the following: Piping the stdout of a command into the stdin of another is a powerful technique. But, what if you need to pipe the stdout of multiple commands? This is where process substitution comes in. In other words, can process substitution do whatever pipe can do? What can process substitution do, but pipe cannot?", "What do you call a person who is always online on the Internet? Is there any specific word for a person who is always online on the Internet? I am just curious to know because staying online is like a profession nowadays.", "Infinite sum of ideals I've been trying to prove that given a ring $R$ and a collection of ideals $\\{I_{\\beta}\\}_{\\beta \\in B}$ in $R$, the set $$\\sum_{\\beta \\in B} I_{\\beta}=\\{f_1+\\cdots+f_r:f_j \\in I_{\\beta_j}, \\mbox{ for some } I_{\\beta_j}\\}$$ is an ideal and is the smallest ideal containing $\\cup_{\\beta \\in B} I_{\\beta}$. I've already proved when I only have two ideals, and so, using induction, I've seen it for finite sums. But I don't see how to generalise that to an arbitrary family of indexes (maybe infinite) $\\beta$. Could someone please give me a hand? Thank you.", "What is EV, when used as an absolute measurement?", "How do you know when to wean? What signs can a baby show to indicate he/she is ready for weaning? What does a parent look for to determine the right timing for this for baby, mom and family?", "How to list files installed by a snap package? After a snap has been installed with sudo snap install [package] how can I list the files which have been installed by the snap?", "From by Richard Brualdi We have a chess master. He has 11 weeks to prepare for a competition so he decides that he will practice everyday by playing at least 1 game a day. To make sure that he's able to take a couple of breaks, he also decides that he wont play more than 12 games per week. My question is, how do you prove/dis-prove that there will be a succession of (consecutive) days in which he will play k games, $k \\geq 22$? Specifically, I don't quite understand the use of the pigeonhole principle here. Thanks in advance! :D EDIT I'll try to clarify what I'm asking: The goal is to prove that for every possible practice schedule that the chess master makes, there will always be a consecutive sequence of days such that he plays exactly k games. So for example, if k = 22, how do you prove that no matter what his schedule is like, he will always play exactly k games in r days, $1 \\leq r\\leq 77$. My main question is: what is the general method for proving different values of k? Are there values of k (from 1 to 132 inclusive) that are impossible to obtain? Note that he does not necessarily have to play 132 games within 77 days! Also, keep in mind the bounds of k.", "How Can I prove (a+b) mod m = (a mod m) + (b mod m)) mod m? modular arithmetic How Can I prove (a+b) mod m = (a mod m) + (b mod m)) mod m ?", "Java reflection: how to get field value from an object, not knowing its class", "Problem recreating BCD on Windows 7 64bit - The requested system device cannot be found", "JSonNet boolean serialization", "Which is better to do client side or server side validation? In our situation we are using jQuery and MVC. JSON data to pass between our View and Controller. A lot of the validation I do is validating data as users enter it. For example I use the the keypress event to prevent letters in a text box, set a max number of characters and that a number is with in a range. I guess the better question would be, Are there any benefits to doing server side validation over client side? Awesome answers everyone. The website that we have is password protected and for a small user base(&lt;50). If they are not running JavaScript we will send ninjas. But if we were designing a site for everyone one I'd agree to do validation on both sides.", "How to import Illustrator swatch libraries into InDesign - Adobe Indesign Mac? I have a very reach swatch library in adobe-illustrator like food colors and.... But in adobe-indesign I don't have many colors. Why? Can I import them to indesign?", "Do characters provoke opportunity attack when they leave another character's reach who is not facing them? \"You can make an opportunity attack when a hostile creature that YOU CAN SEE moves out of your reach.\" In 5E do you have to specify which way your character is facing at all times? If an enemy who is behind him leaves melee range but his back is to him does that enemy provoke an opportunity attack? Are enemies within five feet and 360 degrees of a character considered to be within reach? For example... Kruska and Atone are attacking Dip. Dip is facing or only attacking Kruska. Then Atone moves out of Dip's reach (melee range 5 feet) to engage a silly looking wizard. Does Atone's move provoke an opportunity attack from Dip even though he's not facing him? Is he assumed to be able to see him?", "While explaining to my nephew about the physics of light, I told him we cannot see infrared color, and he kicked back with a very simple question: why can't we see it? I could not tell him. Is the human eye unable to sense such light or can it indeed but the brain can't understand the signal? any other reason?" ]

[ "The is the stuff of legend () and is . My question is two-fold, really: Is the Golden Ratio really a good tool used in modern design (defined here as 20th century on forward), and if so, how often is it used outside of the aforementioned known uses? EDIT: To @e100's first comment, examples of modern use of the Golden Ratio would be a great thing to add here if there any documented or arguably conclusive uses of it.", "I have currently a strange problem on debian (wheezy/amd64). I have created a chroot to install a server (i can't give any more detail about it, sorry). Let's call its path /chr_path/. To make things easy, I have initialized this chroot with a debootstrap (also wheezy/amd64). All seemed to work well inside the chroot but when I started the installer script of my server I got : zsh: Not found /some_path/perl (the installer includes a perl binary for some reasons) Naturally, I checked the /some_path/ location and I found the \"perl\" binary. file in chroot environment returns : /some_path/perl ELF 32-bit LSB executable, Intel 80386, version 1 (SYSV), dynamically linked (uses shared libs), for GNU/Linux 2.2.5, not stripped The file exists, seems ok, has correct rights. I can use file, ls, vim on it but as soon as I try to execute it - ./perl for example - I get : zsh: Not found ./perl. This situation is quite understandable for me. Moreover : I can execute other basic binaries (/bin/ls,...) in the chroot without getting errors I have the same problems for other binaries that came with the project When I try to execute the binary from the main root (/chr_path/some_path/perl), it works. I have tried to put one of the binaries with a copy of my ls. I checked that the access rights were the same but this didn't change anything (one was working, and the other wasn't)", "Differential equation with resonance", "ViewParam vs @ManagedProperty(value = \"#{param.id}\")", "Title does not specify \"On Hold\" Testing the app, I noticed the title does not specify if a question is \"On Hold\" ... I haven't checked specifically, but would assume it doesn't specify as \"Duplicate\" either ... Or am I missing it somewhere? Is it not in the title but located/displayed some other way? If it is, this could be very confusing to users. If it isn't there, it's definitely confusing to users :-) Using: Version 1.0.1.125 on iPad3 with iOS8", "which vectors are perpendicular to each other? $\\vec a = (1, -2, 3)$, $\\vec b = (5, 4, 1)$, $\\vec c = (1, 0, -5)$ Do i just take the dot product of 2 of them. If the dot product they are at $90^\\circ$? But how do i know if there perpendicular?", "Quaternions, Rotations and Real numbers I haven't really formally studied Algebra at anywhere near this level, but I was told about the existence of Quaternions a few years ago and I find them really cool. I also like how pure quaternions are analogous to cross products in $R^3$, and that it gives me a way of doing it algebraically rather than relying on hand rules. Over the course of using them it's my understanding that multiplying an element by another, both imaginary numbers, rotates it in some manner so as to be orthogonal to both, similar to rotations of $\\frac{\\pi}{2}$ in the space with one real and one imaginary axis when multiplied by $i$, which is why it's useful for cross products as it will rotate it to be orthogonal to a plane spanned by linear combinations of those two vectors [afaik]. What I can't intuit though is why for any pure quaternion multiplication, there's a negative real part [the scalar product] if it's meant to correspond to a rotation within $R^3$ and the space of pure Quaternions is Isomorphic to $R^3$. Similarly I don't understand why $i^2 = j^2 = k^2 = $ A negative real.", "I have a file: Base.h class Base; class DerivedA : public Base; class DerivedB : public Base; /*etc...*/ and another file: BaseFactory.h #include \"Base.h\" class BaseFactory { public: BaseFactory(const string &amp;sClassName){msClassName = sClassName;}; Base * Create() { if(msClassName == \"DerivedA\") { return new DerivedA(); } else if(msClassName == \"DerivedB\") { return new DerivedB(); } else if(/*etc...*/) { /*etc...*/ } }; private: string msClassName; }; /*etc.*/ Is there a way to somehow convert this string to an actual type (class), so that BaseFactory wouldn't have to know all the possible Derived classes, and have if() for each one of them? Can I produce a class from this string? I think this can be done in C# through Reflection. Is there something similar in C++?", "A method to count occurrences in a list", "Images as Planes in Eevee having weird transparency", "As the output of df -h shows here, something is eating up 5GB of free space. So, it's not available to use. I'm also noticing sometimes that the hard disk gets filled up to 100% sometimes. So, I had to restart the machine or delete some unncessary files. Only noticed these in /home partition. Don't know whether these two are related, but appreciate if anyone can put some insight into this. $ df -h Filesystem Size Used Avail Use% Mounted on /dev/sda8 100G 92G 2.7G 98% /home", "I'm trying to watch for any new output of a log file. Another script (not under my control) is deleting the file then creating a new one with the same name. Using tail -f doesn't work because the file is being deleted.", "\\includegraphics cannot handle filenames that contain more than the one dot, separating the filename from the extension. Apparently it uses everything after the first dot as extension and then, of course, complains about an unknown graphics extension. This is annoying as I very often have filenames that contain parameter values, e.g. plot_a0.4_b0.6.pdf. Is there a way to teach LaTeX to interpret only the string behind the last dot as extension?", "I've been having an argument with a colleague about this sentence, could you please let me know which one of us is correct: There are no shortage of applications for our product in this space. She is convinced that are should be replaced by is, and I think it should stand as it is. Thanks for your help!", "How to change an application icon programmatically in Android?", "What's the difference between the snap folder in /home/&lt;UserName&gt; and the snap folder in root (/)? I'm trying to get a grasp on where programs and their files are stored when you install them. The first and only program I have installed on my machine is Spotify. I noticed that there were two spotify folders within two separate snap folders. One in the home directory and one in the root directory. Questions Why are there two snap folders? Why are there two spotify folders? Are they different in any way (the snap and spotify folders)? NOTE: I installed Spotify via the Ubuntu Software application, not via the Terminal.", "Are there rules for falling in water vs. diving vs. just jumping in for various depths of water? Just realized that in DMing 5e I have unconsciously used a falling-in-water rule-of-thumb that I inherited from somewhere (maybe 2e or AD&amp;D or maybe even Pathfinder). The ruling I've been using is as follows: No damage for 20 feet of falling. Half-damage next 20 feet. Normal damage beyond that. Realizing there should be a Strength (Athletics) for \"swimming\" (in context, \"diving\") to take even less damage with a proper dive in sufficiently deep water, I started to look for specifics on that. Am I just missing it somewhere? (Also didn't find it searching this stack.) Are there clear 5e rules for both jumping and diving in water of various depths?", "Below is the text in the file: Pseudo name=Apple Code=42B state=fault Pseudo name=Prance Code=43B state=good I need to grep for \"42B\" and get the output from the above text like: Pseudo name=Apple Code=42B state=fault Does anyone have idea on how to achieve this using grep/awk/sed?", "I already have cast iron skillet but I can't find a decent \"normal\" pan, for eggs and stuff, sometimes steaks, more or less general purpose. Here are some more features: high quality, durable, non stick, oven safe, dish washer safe, extremely flat surface - not to be higher in the middle, this is very important. Of course pricier usually means better quality, but is it worth it based on the criteria I'm after? Is it likely to be worth going from pans below $60, to pans from $60 to $130, or to pans over $130?", "Custom entity datetime field in calendar" ]

[ "I have a .net client application which is connected to a remote database. Is it safe to keep a single connection open for the lifetime of the client (hours)? Does the answer hold if I have multiple (10 or 100) clients running?", "What is the difference between ANSI/ISO C++ and C++/CLI?", "mysqldump, preserve update_time and modify_time attributes as listed by show table status from Does mysqldump preserve the create_time and update_time attributes that are output by show table status from? If not, is there an option that does this? it looks like mysqldump preserves this data if you export to XML. EDIT: Well the data is included in the export. Whether it's read in at the other end I'm not sure. Is there a way to do this with a normal .sql dump?", "So, to explain the title, I'm referring to the necessity of the axiom of choice in the existence of a well ordering on reals, or any uncountable set. Now, while tweaking some sets, I came across this : We start with the natural numbers, $N$. We take the power set of the naturals, $P(N)$. Then we remove all the finite subsets of $N$ from $P(N)$. Let us call this new set $S$. This set is the set of all infinite subsets of $N$. It is easy to show that $S$ has uncountable cardinality, same as that of real numbers. This is because the removal of finite subsets only removes a countable number of elements. (Haven't posted this deduction, for it is very easy, but I may post it if it is not so evident) Now, we seek to find an ordering on the set $S$. Every set in this set is an infinite subset of natural numbers, so each of these sets are well ordered by the natural ordering of $N$. Taking any two sets in $S$, say $A$, and $B$, we seek to order them by checking their elements lexicographically. We compare the first two elements in $A$, and $B$. Let them be $a_1$, and $b_1$ respectively. If $a_1 = b_1$, then we move on to the second elements in the sets, $a_2$, and $b_2$, and so on. If, at any point, $a_n &lt; b_n$, then $A &lt; B$, or if $b_n &lt; a_n$, then $B &lt; A$. This order seems to be a well ordering of the uncountable infinity of reals. I don't seem to have invoked the axiom of choice anywhere in the construction of this set $S$. So, why isn't this a well ordering on the uncountable of reals?", "I'd like to install a client for Xubuntu (12.04). I'm getting non-English Google results, and I didn't find in the Xubuntu repositories. Does anyone know of a client that works well for Ubuntu or it's supported derivates (or installation instructions for grive?)", "Is better healthcare a bane to the long-term survival of the human race? The theory of natural selection has it that individuals with better genes tend to survive and reproduce, passing their genes to their offspring. This gradual process results in a population more adapted at survival. However, due to the advancement in medical science, humans with poorer genes tend to survive and reproduce just as well. For example, in the past, many people, excluding those with natural immunity due to some genetic mutations, would have succumbed to illnesses such as malaria and typhoid. But with better hygiene and medical treatment, these patients tend to survive. Now, imagine a future where all illnesses including cancer can be treated. How would it impact the survival of the human race? Would we become more and more vulnerable such that our survival hinges heavily on medical technology, analogous to how an astronaut's survival is dependent on his spacesuit?", "If I push or hit an object in space will it rotate or move along a straight line?", "Every time I think I have the curve modifier mastered, it throws me a another curve ball (no pun intended). Why in can I not get the lights to follow the spiral curve? When the modifier is activated, the lights are stretched and distorted along the curve. I created the curve by converting it from a mesh (string of verts). Why does it not display like a normal Bezier? Is that related to my problem? I am following all the \"rules\" that I am aware of, as detailed here: . The curve seems to run in the correct direction. The origin point is at the first point of the curve. The curve modifier on the lights is set to -Y which is the local orientation of the curve's direction. What am I missing?", "How to make child process die after parent exits? Suppose I have a process which spawns exactly one child process. Now when the parent process exits for whatever reason (normally or abnormally, by kill, ^C, assert failure or anything else) I want the child process to die. How to do that correctly? Some similar question on stackoverflow: (asked earlier) (asked later) Some similar question on stackoverflow for Windows:", "Connecting multiple grounds As I'm relatively new to the electronics world, I was wondering if you can connect multiple ground terminals (corresponding to several different voltage outputs) to the same ground. Or do they each need their own? In my case I have 5 lines, one 12V, one 3.3V, two 5V and one variable from a 12V in using a voltage regulator that already has its own ground. So I'm guessing that each would need its own ground, but it is never bad to ask.", "Inequality with Binomial distribution Let $n$ and $1\\leq k \\leq n$ be natural numbers. Prove the inequality $$\\sum_{i=k}^n \\binom{n}{i}\\bigg(\\frac{k}{n+1}\\bigg)^i\\bigg(1-\\frac{k}{n+1}\\bigg)^{n-i} \\leq 1 - \\frac{1}{e} $$ Equivalently, if $X\\sim$ Bin($n$,$\\frac{k}{n+1}$), prove that $\\mathbb{P}[X\\geq k] \\leq 1 - \\frac{1}{e}$. My attempt: It may be helpful to show that the LHS tends to $1-\\frac{1}{e}$ as $n \\to \\infty$ (already did that) and that the LHS is an increasing function on $n$ (have not done that).", "Uk Visa Refused need guidelines etc,,, I am from Pakistan I applied for 4x Weeks UK family visit visa with my 6x years daughter and they refused, my refusal issue is same. I am going to quote my refusal letter. You stated they you are employed with A----- company and Earning Rs. ____ per month in support of your application you have provided a latter from your employer. However I am not satisfied that one document alone demonstrates that you have the employment status and earning claimed. You also state that your spouse is employer with ___ Company and Earning Rs. ____ per month in support of your application you have provided a latter from your employer However I am not satisfied that one document alone demonstrates that you have the employment status and earning claimed with out further corroborating evidence. I note that you have declared no other personnel income, savings or assets. Based on the information provided i am not satisfied that your circumstances are as claimed and that you have demonstrated strong economic financial ties to Pakistan. It is your responsibility to satisfy me that your circumstance in Pakistan are such that if granted leave to enter you will abide by all the conditions attached to any such leave and that you will leave the uk on completion of the proposed visit but you have failed to do so. therefore I am not satisfied that you are seeking a genuine visit or that you intend to leave the uk at the end of your visit your application for visit visa has been refused paragraph V4.2(a) and (c) I am not satisfied that you have sufficient funds to cover all reasonable costs in relation to your visit including the cost of your journey. any cost relating to dependents and the cost of any planned activities. your application for visit visa has been refused under paragraph V4.2(e). ,,, These objections and reasons are not as like they thinking I have my bank statement and transactions including Rs. 4 lac balance I have transactions of my salary in statement and my husband recently employed he is also have his salary transaction in the same statement because we both using our joint account. I just want to go Uk and meet my family for 4x weeks and I am with my 6 years daughter my husband is not going with us due to his job. Now please guide me should I go for Administration review and provide them my bank statement because my visa rejected on 26 July 2016 I still have time period for administration review OR I should reapply immediately to remove all these objections and give them more evidences I mean bank statement and our pay slips etc? Kindly guide me what to do which way will work.. Your quick help and guidelines will help me.", "Disabling SSLv3 but still supporting SSLv2Hello in Apache Many SSL clients, notably JDK 6, use the SSLv2Hello protocol to handshake with the server. Using this protocol does not mean you are using SSL 2.0 or 3.0 for that matter; it is merely a handshake to determine which protocol to use. [ However, in Apache, if you disable SSLv3 support, this apparently removes support for the SSLv2Hello protocol. Apache Tomcat has explicit support for SSLv2Hello; that is, you can enable that, but not enable SSLv3. Is there any way to do this in Apache? [Update] This is my protocol config: SSLProtocol +TLSv1 +TLSv1.1 +TLSv1.2 -SSLv3", "How can I make a time delay in Python? I would like to know how to put a time delay in a Python script.", "How do I use RSolve to solve a system of recurrence relations?", "Find the value of $P(1)$ Let $P (x) = x^2 + bx + c$, where $b$ and $c$ are integer. If $P(x)$ is a factor of both $x^4 + 6x^2 + 25$ and $3x^4 + 4x^2 + 28x + 5$, find the value of $P(1)$. I am not being able to solve this.Some hints/suggestions? Tell me if I can edit to improve this question.I could'nt try much.Got stuck.", "Aliens abduct mathematician, astronomer, woman Bits I remember about this SF movie which probably originated in late 50s / early 60s: Humans are flying in a light, general aviation, high winged, single engine aircraft. An alien in a flying saucer abducts the whole kit &amp; kaboodle (plane &amp; passengers). Takes them to a secret terrestrial base Eventually tells them that his computer is damaged and he needs their help to get back to his planet. He needs an astronomer for planetary masses &amp; other information. He needs a mathematician to calculate trajectories and perform other calculations. He needs the woman as eye candy, lol They eventually make it back to the alien home planet which is under attack by its enemy. The attacking aliens are bombarding the original alien's home planet with meteors / asteroids. That's about all I remember.", "Suppose the mean noon-time temperature for September days in San Diego is 24∘ and the standard deviation is 4.9. (Temperature in this problem is measured in degrees celsius) On September 26, 1963, the all-time record of noon-time temperature in San Diego of 44∘ was hit. Assume the temperature distribution is symmetric around the mean, what is the Chebyshev bound for the probability of breaking (or tieing) this record? I am having a hard time understanding this. Could someone explain to me how to do this?", "How many passes do you need to wipe/shred your files to make them not undeletable?", "What is a plain English explanation of \"Big O\" notation?" ]

[ "New \"[tag:\" syntax interferes with Markdown links", "Are there attacks that break collision resistance but not preimage resistance? Are there any examples of attacks on hash functions which: break collision resistance and second preimage resistant, or break collision resistance and preimage resistant? I have looked at Rogaway's paper1, but it seems complicated, hence was wondering if a succinct example exists. 1) Phillip Rogaway and Tom Shrimpton. Fast Software Encryption (FSE) 2004, LNCS vol. 3017, pp. 371&ndash;388, Springer, 2004.", "I found this confusing when I use the neural network toolbox in Matlab. It divided the raw data set into three parts: training set validation set test set I notice in many training or learning algorithm, the data is often divided into 2 parts, the training set and the test set. My questions are: what is the difference between validation set and test set? Is the validation set really specific to neural network? Or it is optional. To go further, is there a difference between validation and testing in context of machine learning?", "How do I pass parameter TO a Visualforce page from a link in an email? Here's what I am trying to do: 1) User creates record A. 2) Time-based workflow sends an email to the Record A creator based on a date field in the record. 3) The email template has a URL link. 4) The URL links to a Visualforce page that is basically a form with fields to be filled out (this Visualforce page is in a managed package) and a save button that creates a new User record. 5) When the User clicks the URL link in the email, the Visualforce page opens in a new window. 6) I would like to pass the values of the fields in record A to pre-fill the Visualforce page fields. Here's my link: &lt;a href=\"https://cs19.visual.force.com/apex/CloneThisUser?Desktop=true&amp;Id={!Pending_User__c.User_to_CloneId__c}&amp;formGroupInputSmall={!Pending_User__c.First_Name__c} And here's the code from the relevant section of the Visualforce page: &lt;div class=\"form-group form-group-sm\"&gt; &lt;!-- &lt;apex:outputLabel styleClass=\"col-sm-2 control-label\" for=\"formGroupInputSmall\"&gt;First Name&lt;/apex:outputLabel&gt; --&gt; &lt;div class=\"col-xm-11 col-sm-12\"&gt; &lt;apex:inputField html-placeholder=\"First Name\" styleClass=\"form-control FirstNameInput\" value=\"{!u.FirstName}\" id=\"formGroupInputSmall\"/&gt; &lt;/div&gt; &lt;/div&gt; I have only included the first field I would like to pass the parameter to, in order to keep this post simple. The link passes the User_to_Clone_Id__c just fine but does not fill in the \"First Name\" field with the value of the First_Name__c . What am I doing incorrectly? Thanks.", "When I wake the laptop from the sleep I need to get the VPN state as I left it (turned on). Can't find the setting of autoconnect in VPN settings... Need some easy way to ask the system to autoconnect the VPN when the internet is available. Edit based on comments: Ubuntu 18.04 has no option to Always connect to VPN when using using this connection.", "NULL values inside NOT IN clause", "Open terminal window and execute Python script on startup I have a Python script which I would like to execute at every startup. I can run it by adding this to the startup applications: python3 /path/to/script.py That works, but it doesn't open a terminal window, so I can't see the program's output. How could I make it open a terminal window and execute the script in there? Note: I get the window to stay open with input(' ') at the end of the Python script. Thanks!", "A single word for someone who spends their wealth very foolishly", "I am using my notes app on OSX 10.11.5 and iOS 8. For the most part, things are working, but I am noticing that many of my older notes are not searchable. When I type something in the search box, these older notes do not appear in search results even if there is a match. However, if I edit a note or create a new one, it is fully searchable. My guess is that somehow the search indexes for my notes got corrupted. Is there any way to fix this or rebuild the indexes?", "When can I be sure a questionable check has cleared?", "I have a list of hosts in the network providing shares via SAMBA. How can I determine either IP address or the host name of one particular host, e.g. the one with the name “SASAK02”. The output of smbtree is as follows WORKGROUP \\\\SASAK02 \\\\SAURA-PC1 \\\\PC-VAN-DAMME", "Chance of selecting the last k pages in correct order from a set of n pages", "I couldn't find much on the new Lucene-based search, and don't know much about the engine in general, so I'm asking this question. Does anybody have a description of how search results are ranked? Does the rank calculation include: rep of post's author? views? unique referers? PageRank of referers? rank of questions that link to the post? whether a question is closed? vote count? answer count?", "If $\\left(1+\\sin \\phi\\right)\\cdot \\left(1+\\cos \\phi\\right) = \\frac{5}{4}\\;,$ Then $\\left(1-\\sin \\phi\\right)\\cdot \\left(1-\\cos \\phi\\right)$ If $\\displaystyle \\left(1+\\sin \\phi\\right)\\cdot \\left(1+\\cos \\phi\\right) = \\frac{5}{4}\\;,$ Then $\\left(1-\\sin \\phi\\right)\\cdot \\left(1-\\cos \\phi\\right) = $ $\\bf{My\\; Try::}$ Given $\\displaystyle \\left(1+\\sin \\phi\\right)\\cdot \\left(1+\\cos \\phi\\right) = \\frac{5}{4}\\Rightarrow 1+\\sin \\phi\\cdot \\cos \\phi+\\sin \\phi+\\cos \\phi = \\frac{5}{4}.$ So $\\displaystyle \\sin \\phi+\\cos \\phi+\\sin \\phi \\cdot \\cos \\phi = \\frac{1}{4}\\Rightarrow \\left(\\sin \\phi+\\cos \\phi\\right) = \\frac{1}{4}-\\sin \\phi \\cdot \\cos \\phi.$ Now $\\displaystyle \\left(1-\\sin \\phi\\right)\\cdot \\left(1-\\cos \\phi\\right) = 1-\\left(\\sin \\phi+\\cos \\phi\\right)+\\sin \\phi \\cdot \\cos \\phi =\\frac{3}{4}+\\sin 2\\phi$ Now How can I calculate $\\sin 2\\phi.$ Help me, Thanks", "Apply SP3 on SQL Server 2012 AlwaysOn AAGs", "I just want to write \\Sha without ruining everything I realize similar questions have been asked before but I am not satisfied with any of the answers I've seen. I would like to use the Cyrillic letter Ш to denote a particular group in mathematics. Most solutions involve using OT2 or T2A encoding; for example, at . However, this makes the other text in the document look bad. For example, using the solution above, I get while I would like to have The first seems to be shaded strangely and the characters don't seem to align right. Does anyone know how I can write the character Ш (in math mode) without changing the default font for the rest of the text?", "function a () { return \"foo\"; } a.b = function () { return \"bar\"; } function c () { }; c.prototype = a; var d = new c(); d.b(); // returns \"bar\" d(); // throws exception, d is not a function Is there some way for d to be a function, and yet still inherit properties from a?", "Can you deliver it [when,after] it [is | will be] assembled? Right now we are assembling a device. I am asking another person if he is can deliver it [after/when] we finish. What question construction is the most correct? Can you deliver it after it is assembled? Can you deliver it after it will be assembled? Can you deliver it when it will be assembled? Can you deliver it when it is assembled?", "What are the differences between \"lay\" and \"lie\"?", "In they've somehow created \"wireless\" networks, meaning networks that connect two components but don't have an actual wire in the schematics. What are these called, and how can I create them in Eagle Cad 6.5?" ]

[ "Interpretation of simple predictions to odds ratios in logistic regression I'm somewhat new to using logistic regression, and a bit confused by a discrepancy between my interpretations of the following values which I thought would be the same: exponentiated beta values predicted probability of the outcome using beta values. Here is a simplified version of the model I am using, where undernutrition and insurance are both binary, and wealth is continuous: Under.Nutrition ~ insurance + wealth My (actual) model returns an exponentiated beta value of .8 for insurance, which I would interpret as: \"The probability of being undernourished for an insured individual is .8 times the probability of being undernourished for an uninsured individual.\" However, when I calculate the difference in probabilities for individuals by putting in values of 0 and 1 into the insurance variable and the mean value for wealth, the difference in undernutrition is only .04. That is calculated as follows: Probability Undernourished = exp(β0 + β1*Insurance + β2*Wealth) / (1+exp(β0 + β1*Insurance + β2*wealth)) I would really appreciate it if someone could explain why these values are different, and what a better interpretation (particularly for the second value) might be. Further Clarification Edits As I understand it, the probability of being under-nourished for an uninsured person (where B1 corresponds to insurance) is: Prob(Unins) = exp(β0 + β1*0 + β2*Wealth) / (1+exp(β0 + β1*0+ β2*wealth)) While the Probability of being under-nourished for an insured person is: Prob(Ins)= exp(β0 + β1*1 + β2*Wealth) / (1+exp(β0 + β1*1+ β2*wealth)) The odds of being undernourished for an uninsured person compared to an insured person is: exp(B1) Is there a way to translate between these values (mathematically)? I'm still a bit confused by this equation (where I should probably be a different value on the RHS): Prob(Ins) - Prob(Unins) != exp(B) In layman's terms, the question is why doesn't insuring an individual change their probability of being under-nourished as much as the odds ratio indicates it does? In my data, Prob(Ins) - Prob(Unins) = .04, where the exponentiated beta value is .8 (so why is the difference not .2?)", "Software center disappeared [19.10] I have had trouble with sound (now fixed) since upgrading to 19.10, and in the middle of trying the common solutions, the Software Center \"disappeared\". I got aware of quite late, so I don't know what caused it. Anyway, would you know how to reinstall it ? Trying sudo apt-get install software-center doesn't work.", "Find all the numbers $n$ such that $\\frac{4n-5}{60-12n}$ can't be reduced.", "C: pointer to struct in the struct definition", "Logarithmic y-axis and restrict y to domain fails I'm trying to plot data with a logarithmic y-axis and restricting the y-data to a specified domain, but compilation fails for a reason I don't understand. This is the code: \\documentclass{standalone} \\usepackage{pgfplots} \\begin{document}% \\begin{tikzpicture} \\begin{axis}[ymode=log, restrict y to domain=1:6] \\addplot coordinates {(0, 1.1e1) (1, 1.7e3) (2, 0.0e0) (2, 3.4e7) (4, 8.1e5)}; \\end{axis} \\end{tikzpicture} \\end{document} Running it results in an error message: ! Missing number, treated as zero. &lt;to be read again&gt; i l.6 ..., 1.7e3) (2, 0.0e0) (2, 3.4e7) (4, 8.1e5)}; According to the pgfplots manual for version 1.5.1 (29 December 2011), page 272 (about restrict x/y/z to domain), For logarithmic axes, min and max are logs of the respective values. If I disable either the logarithmic y-axis or the domain-restriction, the code runs successfully and output is as expected (but not as desired). Software versions: pdfTeX, Version 3.1415926-2.3-1.40.12 (TeX Live 2011) (format=pdflatex 2012.5.30) pgfplots 2011/12/29 v1.5.1 (git show 1.5.1-4-g53e640f ) tikz 2010/10/13 v2.10 (rcs-revision 1.76). What's going on? What am I doing wrong? Or is this a bug?", "I have a list of requirements for a program, but I don't know what program meets these criteria. That's about general-purpose software, for example, not a programming IDE or statistical workbench, questions about which would certainly go to respective sites. Is this question appropriate on Stack Overflow? Where should I ask about it? On Super User or elsewhere?", "What is the correct way to get a pgfkey value?", "Prove that $(p+q)^m \\leq p^m+q^m$ If $p,q$ are positive quantities and $0 \\leq m\\leq 1$ then Prove that $$(p+q)^m \\leq p^m+q^m$$ Trial: For $m=0$, $(p+q)^0=1 &lt; 2= p^0+q^0$ and for $m=1$, $(p+q)^1=p+q =p^1+q^1$. So, For $m=0,1$ the inequality is true.How I show that the inequality is also true for $0 &lt; m &lt; 1$. Please help.", "Is there any way of modifying the preamble, so instead of typing $\\mathtt{x}$ ... \\begin{eqnarray} \\mathtt{y} &amp; \\mathtt{=} &amp; \\mathtt{z^\\pi} \\end{eqnarray} I can omit the \\mathtt{...} commands?", "A man wonders why perforations don't work. He decides nothing is the strongest thing in the universe. He exploits his finding.", "‘It’ – ambiguous antecedent?", "Converse to Hilbert basis theorem Prove the converse to Hilbert basis theoren: If the polynomial ring $R[x]$ is Noetherian, then $R$ is noetherian.", "How do I take great HDR photos of moving objects? By moving objects, I mean cities with cars, ocean with moving water, malls with people moving by. I tried it on moving people and had noticeable ghosting, using bracketed shots at + and - 2ev. What's the basic technique on getting sharp looking HDR photos in areas that are moving? I'm assuming it's not bracketed shots but a single shot with exposure editing?", "Trim string in JavaScript? How do I trim a string in JavaScript? That is, how do I remove all whitespace from the beginning and the end of the string in JavaScript?", "Cosmological constant doubts", "Is there a constraint that restricts my generic method to numeric types? Can anyone tell me if there is a way with generics to limit a generic type argument T to only: Int16 Int32 Int64 UInt16 UInt32 UInt64 I'm aware of the where keyword, but can't find an interface for only these types, Something like: static bool IntegerFunction&lt;T&gt;(T value) where T : INumeric", "How do I design a user friendly survey with more than 150 questions? I am designing UI/UX for a survey webapp which has more than 150 questions. Right now they are using 5 radio buttons for each question. Similar to the image below: So the question is, how to make it super user friendly, easy and fun to do? Further I am looking for a solution from responsive web design perspective too. I hate designing it like the following image below but what are some other options.", "Aliens abduct mathematician, astronomer, woman Bits I remember about this SF movie which probably originated in late 50s / early 60s: Humans are flying in a light, general aviation, high winged, single engine aircraft. An alien in a flying saucer abducts the whole kit &amp; kaboodle (plane &amp; passengers). Takes them to a secret terrestrial base Eventually tells them that his computer is damaged and he needs their help to get back to his planet. He needs an astronomer for planetary masses &amp; other information. He needs a mathematician to calculate trajectories and perform other calculations. He needs the woman as eye candy, lol They eventually make it back to the alien home planet which is under attack by its enemy. The attacking aliens are bombarding the original alien's home planet with meteors / asteroids. That's about all I remember.", "When to use \\par and when \\\\, \\newline, or blank lines What is the difference between \\par, \\newline, \\\\ and blank lines? When should I use which one?", "Explain $\\iint \\mathrm dx\\,\\mathrm dy = \\iint r \\,\\mathrm \\,d\\alpha\\,\\mathrm dr$" ]

[ "How to change horizontal alignment of \\frac? Typing \\frac{W+W^*}{2} gives a fraction in which the denominator appears to the eye to be in the wrong position. Is there a way to correct this, i.e. place the 2 in under the + (without using arbitrary negative spacing)?", "I'm a big fan of the podcast Astronomy Cast and a while back I was listening to a Q&amp;A episode they did. A listener sent in a question that I found fascinating and have been wondering about ever since. From the show : Arunus Gidgowdusk from Lithuania asks: \"If you took a one kilogram mass and accelerated it close to the speed of light would it form into a black hole? Would it stay a black hole if you then decreased the speed?\" Dr. Gay, an astrophysicist and one of the hosts, explained that she'd asked a number of her colleagues and that none of them could provide a satisfactory answer. I asked her more recently on Facebook if anyone had come forward with one and she said they had not. So I thought maybe this would be a good place to ask.", "How long can eggs be unrefrigerated before becoming unsafe to eat? A friend of mine accidentally left a carton of eggs on her counter, unrefrigerated, for three days. The eggs had been previously refrigerated both at the store and at home. Now she's planning to do some more cooking which requires eggs, and is wondering if it's still safe to use them for baking. I believe she is planning on baking cookies with them, so they would be baked at fairly high temperatures for probably at least 10 minutes. Would this be safe, or are eggs left unrefrigerated for that long not safe for consumption?", "How does the wording \"for each\" work? Some cards in magic has something happen for each {something}. For instance: makes you gain 2 life for each creature you control. Tapping adds one green mana to your mana pool, and you gain 1 life for each non-land card revealed. How is this life gained: all at once or \"one bit\" at a time? Say I tap Selvala and 1 land, and 2 non-lands are revealed: do I gain 2 life, or do I gain 1 life two times? Would have one or two +1/+1 counters placed on it if I had it in play at that point?", "On , sorted by votes, the accepted answer is #3 in order of votes. It appears as number 3 in the list as well. Is this new behavior intended?", "Find the limit of $\\lim\\limits_{(x,y)\\to (0,0)} \\frac{x^2y^2}{x^2y^2+(x-y)^2}$", "I have just updated MiKTeX and have found that pstricks now appears to cause a problem. The error message I'm getting is (\"C:\\Program Files\\MiKTeX 2.9\\tex\\generic\\pstricks\\pstricks.tex\" ! Undefined control sequence. l.31 \\if@check@engine Not sure what's happening here. If I stop pstricks from being loaded things work ok. Is there a known problem with the latest pstricks?", "How does the Golden Ratio/Spiral Work? Is it useful with Logo Design?", "I am wondering whether there exists a function such that: $$\\lim_{x \\rightarrow a}f(x)=\\infty$$ at some point $a$ on the real axis but yet, $$\\int_{-\\infty}^{+\\infty}\\left|f(x)\\right|\\ dx&lt;\\infty$$ Does the fact that a function is unbounded imply that it has no finite integral?", "How do I coat popcorn with flavor?", "Removing unwanted appearance of underlying mesh", "Just as background, I should say I am a mathematics grad student who is trying to learn some physics. I've been reading \"The Theoretical Minimum\" by Susskind and Hrabovsky and on page 134, they introduce transformations. Here's the first example they use: Consider a particle moving in the x,y plane under the influence of a potential, $V$, which depends only on the radius, with Lagrangian: $L=\\frac{m}{2}(\\dot{x}^2+\\dot{y}^2)-V(x^2+y^2)$ This is clearly invariant under rotations: $x \\rightarrow x\\cos \\theta + y\\sin \\theta$ $y \\rightarrow -x\\sin \\theta + y\\cos \\theta$ All well and good. Now they say \"consider what happens ... when the angle $\\theta$ is replaced by an infinitesimal angle $\\delta$.\" Already I could say \"What the heck is $\\delta$ really?\", but I'm willing to play along with my intuition. Since $\\delta$ is infinitesimal, we work to first order and say $\\cos \\delta=1$ and $\\sin \\delta= \\delta$. Plugging this into our rotation formulas above, we obtain: $x \\rightarrow x+y\\delta$ $y \\rightarrow y-x\\delta$ By differentiating, we see that: $\\dot{x} \\rightarrow \\dot{x}+\\dot{y}\\delta$ $\\dot{y} \\rightarrow \\dot{y}-\\dot{x}\\delta$ Plugging these into the Lagrangian and ignoring terms higher than first order, we see that the Lagrangian is invariant under this transformation. My main problem with all of this is that I don't understand what the physical nature of an infinitesimal transformation actually is. All I got from the above was that if you do this formal calculation by following rules like \"only work to first order in $\\delta$,\" then the Lagrangian is invariant. This is in contrast to the case where we have an actual transformation, like a rotation, where there is no question about what is going on physically. I would also like to know how all of this relates to rigorous mathematics. In mathematics, I can't recall ever using infinitesimals in an argument or calculation, so it would be useful if there was some way of formulating the above in terms of limits/ derivatives/ differential forms (for example). I sense a connection to Lie Algebras, as the infinitesimal version of the rotation is $(I+A)$ where $I$ is the identity matrix and $A$ is an element of the Lie Algebra of $SO(2)$. Here are some questions whose answers I believe may be useful to me (feel free to answer some or all): -What is an infinitesimal quantity like $\\delta$ to the physicist? -Why do physicists argue using infinitesimals rather than \"standard\" calculus? -What is the physical meaning of infinitesimal transformation? How does it relate to Lie Algebras? -Is there a rigorous theoretical apparatus for justifying the computations shown above? -What is meant by the Lagrangian being invariant under infinitesimal transformations? If any of the questions seem too vague, please say so. Thanks in advance for your insights!", "What exactly are DLL files, and how do they work? How exactly do DLL files work? There seems to be an awful lot of them, but I don't know what they are or how they work. So, what's the deal with them?", "Combinatorial proof of $\\sum^{n}_{i=1}\\binom{n}{i}i=n2^{n-1}$.", "List comprehension rebinds names even after scope of comprehension. Is this right?", "Origin of the meaning of joe", "Short story with aliens who hear their own thoughts as god-like voices I would have read this about 20-25 years ago. I believe the subject was an alien individual, but it could have been a non-standard human instead. The hook of the story was that the subject lacked an organ like the that allows the halves of the brain to communicate efficiently, allowing the illusion of a single consciousness. The subject is conscious, and has thoughts, but is subject to hearing commands like \"Wash your hands!\" \"Fetch water!\" within its head. I recall the subject (and others like the subject) believing that the voices are their gods talking to them. To the reader it becomes clear that this is a separate part of the subject's own mind that is responsible for long-term planning and simply can't communicate with the rest of the mind in the way a \"normal\" human is accustomed to.", "How can I pass a class member function as a callback?", "Information on month old flights Where can I get flight info for a flight a month ago for an insurance claim? Flight stat sites will only show a weeks worth of data.", "Every time I open a folder from the desktop, a prompt is shown that the said folder is opened. How do I stop that?" ]

[ "I am aware of the basics of evolutionary theory, however I don't understand how mutations can add genes over time. Am I correct in thinking that creatures within the same species who mutate to have an additional gene in their genome would normally be infertile? Or am I misunderstanding that? Can someone explain the process of the creation of genetic material through evolution? Citation to a decent academic paper or book on the matter would be appreciated too.", "Kinematics with non constant acceleration A particle experiences an acceleration described by $$ a=kx^{-2} $$ where x is the displacement from the origin and k is an arbitrary constant. To what value does the velocity v of the particle converge to as x approaches infinity if the particle starts at some point x0? If I approach this problem with energy, then $$ W = \\int F \\mathrm{d}x $$ $$ = \\int_{x_0}^\\infty mkx^{-2} \\mathrm{d}x $$ $$ = mk(-\\infty^{-1}+{x_0}^{-1}) $$ $$ W = K = mk{x_0}^{-1} $$ $$ \\frac{1}{2}mv^2 = mk{x_0}^{-1} $$ $$ v = \\sqrt{2k{x_0}^{-1}} $$ How would I solve this problem with pure kinematics? (there appears to be some sort of cyclical dependency where acceleration affects velocity, velocity affects displacement, and displacement affects acceleration) Likewise, two particles experience accelerations described by $$ a_1=k_1x^{-2} $$ $$and $$ $$ a_2=-k_2x^{-2} $$ where x is the distance between the two particles What two velocities do the particles reach as x approaches infinity if the two particles are initially separated by some x0?", "Why are swap partitions discouraged on SSD drives, are they harmful? I often read that one should not place swap partitions on a SSD drive, as this may harm the device. Is this true? Can you please explain the reason to me? Because I otherwise would have thought that placing swap on an SSD is the best choice, as it's much faster than HDDs and therefore swapping RAM contents to the SSD is not as slow as it would be with the HDD...", "Calculate Time Remaining", "How do I read in the contents of a directory in Perl?", "How to count number of words from String using shell", "Today I've got 10 upvotes for an answer. Answer was a first answer in the question. I got an Nice Answer badge for this, but no Enlightened badge. Shouldn't I get both? is my answer :)", "Let $n\\in\\mathbb N$ and let $a_1,\\ldots,a_n$ be natural numbers smaller than $10^n$. Write each $a_k$ in base $10$ and add $0$'s to the left of each decimal expansion, if needed, so that each $a_k$ is written with $n$ digits. Consider the matrix such that the entries of the $k$th row are the digits of $a_k$ (written in the same order). Let $d\\in\\mathbb N$ be such that $d$ divides each $a_k$. Prove that $d\\mid\\det A$. For instance, suppose that $n=4$ and that your numbers are $3876$, $2784$, $684$, and $8388$, each of which is a multiple of $12$. Then$$A=\\begin{bmatrix}3 &amp; 8 &amp; 7 &amp; 6 \\\\ 2 &amp; 7 &amp; 8 &amp; 4 \\\\ 0 &amp; 6 &amp; 8 &amp; 4 \\\\ 8 &amp; 3 &amp; 8 &amp; 8\\end{bmatrix}$$and $\\det A=-360$, which is, in fact, a multiple of $12$. I learned about this problem yesterday. I found it quite cute and I decided to share it with all of you. Note: I know how to prove it.", "The problem: Consider the smooth quadric $Q=V(X_{0}X_{1}+X_{2}X_{3}+X_{4}^{2})\\subset\\mathbb{P}^{4}$ and the line $L=V(X_{0},X_{2},X_{4})$ contained in it. Prove that there exists a vector bundle $F$ on $Q$ with a section vanishing exactly at $L$. The hardest thing is to get the transition matrices. Any help is appreciated.", "Change font size of labels in figures to any font size I want to change the font size of the label of a figure environment to any font size. It's possible to use the package caption with the argument font=Large for example. But I found no way to choose any font size, e.g. fontsize=28pt. Here an example code: \\documentclass{standalone} \\usepackage{anyfontsize} \\usepackage[font=Large]{caption} %\\usepackage[fontsize=28pt]{caption} % not implemented \\begin{document} \\parbox[t]{20cm}{ \\fontsize{28}{30} \\selectfont \\begin{figure} %\\includegraphics{figure.eps} \\caption{\\label{fig_req_osnr} \\fontsize{28}{30} \\selectfont My caption.} \\end{figure} } \\end{document} Do you have any ideas?", "What's the regular expression that matches a square bracket?", "If parsing the output of ls is dangerous because it can break on some funky characters (spaces, \\n, ... ), what's the best way to know the number of files in a directory? I usualy rely on find to avoid this parsing, but similarly, find mydir | wc -l will break for the same reasons. I'm working on Solaris right now, but I'm looking for a answer as portable across different unices and different shells as possible.", "How to split a string with any whitespace chars as delimiters", "Does adverb placement affect meaning? He swam slowly to the island. He slowly swam to the island. Some experts say that there is a “slight difference” in meaning. Would you please tell me that difference?", "Finding a formula to sum natural numbers up to $n$ Possible Duplicate: I got this question in homework: Find an expression for the sum ‫‪ $\\sum k = 1 +\\cdots + n‬‬$. and prove it using an induction. I'm not even near finding the expression. What I did notice is that if $n$ is (for example) 5 then the sum would be $5^2 - 4^2 + 3^2 - 2^2 + 1^2$ So the first number is always positive and from there on the sign changes. Any tips on how do I contintue from this point on, assuming I'm in the right direction? Thanks!", "My Custom Skin won't Change", "Find a plane that passes through a point and is perpendicular to 2 planes", "no Wi-Fi on Ubuntu 14.04 LTS Asus notebook with MEDIATEK MT7630e I'm new to Ubuntu. I installed it today, but the first thing I encounter is that I can only connect to the Internet through wifi. Can someone help me? iwconfig result : eth0 no wireless extensions. lo no wireless extensions. lspci: 00:00.0 Host bridge: Intel Corporation 3rd Gen Core processor DRAM Controller (rev 09) 00:01.0 PCI bridge: Intel Corporation Xeon E3-1200 v2/3rd Gen Core processor PCI Express Root Port (rev 09) 00:02.0 VGA compatible controller: Intel Corporation 3rd Gen Core processor Graphics Controller (rev 09) 00:14.0 USB controller: Intel Corporation 7 Series/C210 Series Chipset Family USB xHCI Host Controller (rev 04) 00:16.0 Communication controller: Intel Corporation 7 Series/C210 Series Chipset Family MEI Controller #1 (rev 04) 00:1a.0 USB controller: Intel Corporation 7 Series/C210 Series Chipset Family USB Enhanced Host Controller #2 (rev 04) 00:1b.0 Audio device: Intel Corporation 7 Series/C210 Series Chipset Family High Definition Audio Controller (rev 04) 00:1c.0 PCI bridge: Intel Corporation 7 Series/C210 Series Chipset Family PCI Express Root Port 1 (rev c4) 00:1c.1 PCI bridge: Intel Corporation 7 Series/C210 Series Chipset Family PCI Express Root Port 2 (rev c4) 00:1c.3 PCI bridge: Intel Corporation 7 Series/C210 Series Chipset Family PCI Express Root Port 4 (rev c4) 00:1d.0 USB controller: Intel Corporation 7 Series/C210 Series Chipset Family USB Enhanced Host Controller #1 (rev 04) 00:1f.0 ISA bridge: Intel Corporation HM76 Express Chipset LPC Controller (rev 04) 00:1f.2 SATA controller: Intel Corporation 7 Series Chipset Family 6-port SATA Controller [AHCI mode] (rev 04) 00:1f.3 SMBus: Intel Corporation 7 Series/C210 Series Chipset Family SMBus Controller (rev 04) 01:00.0 3D controller: NVIDIA Corporation GF117M [GeForce 610M/710M/820M / GT 620M/625M/630M/720M] (rev a1) 03:00.0 Network controller: MEDIATEK Corp. MT7630e 802.11bgn Wireless Network Adapter 04:00.0 Unassigned class [ff00]: Realtek Semiconductor Co., Ltd. Device 5289 (rev 01) 04:00.2 Ethernet controller: Realtek Semiconductor Co., Ltd. RTL8111/8168/8411 PCI Express Gigabit Ethernet Controller (rev 0a) lspci -nnk | grep 0280 -A2: 03:00.0 Network controller [0280]: MEDIATEK Corp. MT7630e 802.11bgn Wireless Network Adapter [14c3:7630] Subsystem: Foxconn International, Inc. Device [105b:e074] 04:00.0 Unassigned class [ff00]: Realtek Semiconductor Co., Ltd. Device [10ec:5289] (rev 01)", "How to use induction to prove the product rule for higher derivatives? How do I show through mathematical induction that \\begin{equation} \\frac{d^n}{dx^n}[f(x)\\cdot g(x)] = \\sum_{k = 0}^{n} \\binom{n}{k} \\frac{d^k}{dx^k} [f(x)] \\cdot \\frac{d^{n-k}}{dx^{n-k}} [g(x)] \\end{equation} which is the product rule for higher derivatives?", "Let $x \\in \\mathbb R$ Find a closed form of $\\int_0^\\infty\\dfrac{\\cos(xt)}{1+t^2}dt$ . Let me give some context: this is an exercise from an improper integrals course for undergraduates. My teacher was not able to give a valid solution without resorting to Fourier series. He actually wanted to prove first that the function is a solution of the ODE $$ y-y'' =0$$ without succeeding in proving it. Anyway the result sould be $\\dfrac{\\pi}{2}e^{-x}$ Thanks for any help on this subject." ]

[ "I've recently searched how I could get the application's directory in Java. I've finally found the answer but I've needed surprisingly long because searching for such a generic term isn't easy. I think it would be a good idea to compile a list of how to achieve this in multiple languages. Feel free to up/downvote if you (don't) like the idea and please contribute if you like it. Clarification: There's a fine distinction between the directory that contains the executable file and the current working directory (given by pwd under Unix). I was originally interested in the former but feel free to post methods for determining the latter as well (clarifying which one you mean).", "Do we need a global test before post hoc tests? I often hear that post hoc tests after an ANOVA can only be used if the ANOVA itself was significant. However, post hoc tests adjust $p$-values to keep the global type I error rate at 5%, don't they? So why do we need the global test first? If we don't need a global test is the terminology \"post hoc\" correct? Or are there multiple kinds of post hoc tests, some assuming a significant global test result and others without that assumption?", "Is reusing old code for a new assignment considered self plagiarism? How to protect yourself if you consider it to be, and a group partner does not? I am taking a graduate machine learning course and am working with another student in the class on a final project. In his undergraduate studies, the other student wrote code that accomplished a similar task, and mentioned in our previous meeting that we would be able to leverage much of this code for our current project if we wanted to. I responded that I believe it would constitute textbook cheating and self-plagiarism, but the other student disagrees and believes that re-using the code would not constitute self-plagiarism because he himself wrote it, and it would be redundant to re-write what he had already done. Now, the course instructors have made it clear that we are not allowed to use any external libraries to perform certain classes of algorithms for this project. This students' prior code would fall under this category of prohibited tools, but he claims that it doesn't qualify because he wrote the code himself (so it is not an \"external library\"). I believe this is hyperbole, but he disagrees. It is also worth mentioning that this code is licensed under an , though it is not widely used at all. It has gotten to the point where I am uncomfortable going forward with the project by re-using his old code, and he does not want to do work on the project that he considers to be redundant. My worry is that if it turns out we're not allowed to reuse the code, then using it could cause us to fail the course and severely negatively affect our reputations. Even if we don't get caught, I personally feel that it would be unethical to copy-paste old code and present it as though it's fresh code for this current project. I am unsure of how to proceed. I have tried reaching out to the professor of the course some time ago (she has been traveling for some conferences recently and will be for a while) but I have not heard back from her. Additionally, the course TAs have been unwilling to weigh-in on the situation. I have the following questions: Is the above situation usually considered to be self plagiarism? Why or why not? Is the above act typically allowed in an academic setting? Assuming you are in my position, and consider re-using the code to be cheating and/or unethical, what is the best way to proceed; both in terms of how to make progress on the project, how to compromise with my group mate, and how to protect myself if my group mate refuses to budge.", "Names of some months don't make sense I'm not a native English speaker but I'm always trying to do my best. Unfortunately I have a real problem with dates for some odd reason, I couldn't learn when was my birthday until I was 12 years old. Anyway, as I was learning names of the months on English, and since I know some Latin from high school I noticed that English months don't match up with their Latin numeral counterparts. For example: September - 9. month October - 10. month November - 11. month December - 12. month While on latin septem, octo, novem and decem are words for 7, 8, 9 and 10. So, does anyone know why is that. At first I thought it had something to do with switch from Julian to Gregorian calendar but I figured it's too small of a difference. Anyone? :)", "Does a creature with Lifelink provide lifegain equal to its power, or the defender's toughness? I have recently began playing a deck that has a number of creatures with lifelink in it. I want to be certain I understand the mechanic and the following question occurred to me. Which damage total do you use to determine the life gain from lifelink? I had assumed that if a 3/3 creature with lifelink was blocked by a 2/2 creature that the life gain total would be 2, the maximum that the blocker can absorb before dying. This seems to be incorrect, as when I read the example attached to CR 119.4c [...] attacks with a 3/3 creature with wither and lifelink. It’s blocked by a 2/2 creature, [...]. The damage event starts out as [3 damage is dealt to the 2/2 creature, 2 damage is dealt to the 3/3 creature] Have I been short changing myself?", "There are two Java Web Start tags: : x 239 : x 320 Both tags refer to the same technology refers to both wiki point to all questions tagged with clearly relate to Java Web Start I suggest they be merged into (which appears in the auto-complete list if one types \"webstart\" in the Tags box when asking a new question).", "Is there a clever solution to Arnold's \"merchant problem\"? There is a problem that appears in . The problem is also quoted . You take a spoon of wine from a barrel of wine, and you put it into your cup of tea. Then you return a spoon of the (nonuniform!) mixture of tea from your cup to the barrel. Now you have some foreign substance (wine) in the cup and some foreign substance (tea) in the barrel. Which is larger: the quantity of wine in the cup or the quantity of tea in the barrel at the end of your manipulations? Here's my solution: The key is to consider the proportions of wine and tea in the second spoonful (that is, the spoonful of the nonuniform mixture that is transported from the cup to the barrel). Let $s$ be the volume of a spoonful and $c$ be the volume of a cup. The quantity of wine in this second spoonful is $\\frac{s}{s+c}\\cdot s$ and the quantity of tea in this spoonful is $\\frac{c}{s+c}\\cdot s$. Then the quantity of wine left in the cup is $$s-\\frac{s^2}{s+c}=\\frac{sc}{s+c}$$ and the quantity of tea in the barrel now is also $\\frac{cs}{s+c}.$ So the quantities that we are asked to compare are the same. However, Arnol'd also says Children five to six years old like them very much and are able to solve them, but they may be too difficult for university graduates, who are spoiled by formal mathematical training. Given the simple nature of the solution, I'm going to guess that there is a trick to it. How would a six year old solve this problem? My university education is interfering with my thinking.", "Im creating a community user from an Apex code. When our internal users (non-admins) run the code they are getting following error. (This was working fine when we test the feature in sandbox) SObjectException: Field is not writeable: User.ProfileId The code is //Grab Community User Profile Profile p = [Select Id, Name from Profile where Name = :COMMUNITY_PROFILE LIMIT 1]; User PortalUser = new User(); PortalUser.UserName = Con.Email+'-POC'; PortalUser.ContactId = Con.Id; PortalUser.ProfileId = p.id; PortalUser.Email = Con.Email; PortalUser.EmailEncodingKey = 'UTF-8'; PortalUser.FirstName = Con.FirstName; PortalUser.LastName = Con.LastName; PortalUser.TimeZoneSidKey = 'America/Los_Angeles'; PortalUser.LocaleSidKey = 'en_US'; PortalUser.LanguageLocaleKey = 'en_US'; if (Con.LastName.length() &gt;= 8){ PortalUser.Alias = Con.LastName.substring(0, 7); }else{ PortalUser.Alias = Con.LastName; } SObjToInsert.add(PortalUser);", "Do ground seeds contain oil?", "Count down in timeout is cut off The time out countdown which is flying in is missing half of the number. Note the 33 here: Can this be fixed please?", "Lagrange Multipler KKT condition I am looking at SVM, and reviewing Lagrange multiplier. Let's say with the constraint function $$g(x,y) = x^2 + y^2 -1 &gt; 0, $$ I am maximizing $$f(x,y) = x + y -1 .$$ Intuitively, since the constraint function does not provide a finite constrained region, there is no solution, and $f(x,y)$ can infinitely increase. However, if I just plainly proceed with Lagrange multiplier calculation, $$L(x,\\lambda) = (x + y -1) +\\lambda(x^2 + y^2 -1)$$ I get the solution: $$y,x = -\\sqrt{2}/2, \\lambda = 1/\\sqrt{2}$$ And this still satisfies KKT conditions although the solution is wrong. $$g(x) =&gt; 0 , \\lambda =&gt; 0, \\lambda g(x) = 0.$$ I expected that I would have some result that conflicted KKT conditions, but nothing was violated. Does this mean that Lagrange multiplier under KKT conditions can produce a solution that cannot be solved, without giving any indication of intractability? If functions are complicated, what's the systematic way to confirm that the optimization with inequality constraint functions is solvable using Lagrange multiplier?", "SF TV show about a war between humans and aliens?", "JQuery to load Javascript file dynamically", "How does the Comma Operator work How does the comma operator work in C++? For instance, if I do: a = b, c; Does a end up equaling b or c? (Yes, I know this is easy to test - just documenting on here for someone to find the answer quickly.) Update: This question has exposed a nuance when using the comma operator. Just to document this: a = b, c; // a is set to the value of b! a = (b, c); // a is set to the value of c! This question was actually inspired by a typo in code. What was intended to be a = b; c = d; Turned into a = b, // &lt;- Note comma typo! c = d;", "Using singular \"they\" for an animal As I know, (not only &quot;it&quot;). Also, if a person's gender is unknown, . Is it possible to use &quot;they&quot; when we talk about a specific animal and in what context?", "What is integration by parts, really? Integration by parts comes up a lot - for instance, it appears in the definition of a weak derivative / distributional derivative, or as a tool that one can use to turn information about higher derivatives of a function into information about an integral of that function. Concrete examples of this latter category include: proving that $f \\in C^2(S^1)$ implies that the Fourier series of $f$ converges absolutely and uniformly, and the Taylor series expansion with the integral formula for remainder. However, I don't feel like I really understand what integration by parts is really doing. To me, it is just an algebraic trick that follows from the fundamental theorem of calculus and the product rule. Is there some more conceptual way to think about it? How do you think about this useful idea?", "probability of $k$ boxes contain exactly $1$ ball", "Tikzpicture-figure: Order plot data (asc/desc)? I am using a tikzpicture for plotting. the values I want to plot are typical (X,Y) pairs. The x-value is an uninteresting id-value. I want to order the bins ascending/descending according to the y-value, but how do I do that? The figure seems to automatically take the x-values for ordering, how can I override that? (I am not particularly fixed to tikzpicture - its just the first thing that actually worked and displayed the plot....) Following minimal-working example, how could I achieve a reordering according to the y-value? \\documentclass{article} \\usepackage[english]{babel} \\usepackage[T1]{fontenc} \\usepackage[utf8]{inputenc} \\usepackage{relsize} \\usepackage{times} \\usepackage{url} \\usepackage{latexsym} \\usepackage{graphicx} \\usepackage{colortbl} \\usepackage{color} \\usepackage{caption} \\usepackage{pgfplots, pgfplotstable} \\usetikzlibrary{arrows} \\usepackage{amsmath} \\usepackage{multirow} \\usepackage{booktabs} \\usepackage{filecontents} \\definecolor{OgAns}{rgb}{0, 0.8, 0.4} \\begin{filecontents}{testdata.dat} 1 30 2 44 4 26 3 39 \\end{filecontents} \\begin{document} \\begin{figure} \\begin{tikzpicture} \\begin{axis}[ ybar stacked, ymin=0, ymax=100, bar width=5pt, legend style={at={(0.35, -0.4)},anchor=south west}, legend columns=-1 ] \\addplot[ybar,fill=OgAns] file {testdata.dat}; \\end{axis} \\end{tikzpicture} \\end{figure} \\end{document}", "How to use dependency injection for Plugins/Blocks [\\Drupal::formbuilder() and \\Drupal::config()]?", "C Scanf suddenly stopped reading in values" ]

[ "Uniformly convergent implies equicontinuous I'm trying to prove that if I have a sequence of continuously differentiable functions $f_n$ that converge uniformly on $[a,b]$, then $\\{f_n\\}$ is equicontinuous for all $x_0 \\in [a, b]$. My idea is to use uniform convergence to deal with the &quot;tail&quot; and then use continuity to deal with the finitely many $f_n$'s left. But I'm having trouble writing it down.", "Why won't my computer go to sleep automatically? Windows 8 is set to sleep after 30 mins, and it used to work, but recently it's started refusing to sleep. (I can still manually ask it to go to sleep without any issue.) I was having issues a while ago, but it was with my network adapter. That's since been disabled, so it's definitely not that: I've checked to see what devices are able to wake up my machine, but it only appears to be my mouse: Which is odd, because I haven't recently changed my mouse, and more confusing still: The monitor does go to sleep just fine. If it was actually the mouse keeping my system awake, I'm pretty sure the monitor wouldn't go to sleep. I've checked my Wake Timers, and nothing: I've also checked my existing requests... UPDATE: I found something. What to do with it, I don't know... Note: Even when /requests says that there's \"NONE\" under every category, my machine still won't sleep(!). In short: How can I tell what's preventing my computer from Sleeping? UPDATE: Ok, so I now have a few more pieces of the puzzle. I came back to my computer and it was ASLEEP! Lawks! It seems that the only times it doesn't sleep is if VLC Player is open, even if a video isn't actually playing. UPDATE UPDATE: Ok, so it won't sleep sometimes when VLC Player ISN'T running, either. Bah!", "I'm trying to update my system using apt-get, but it's giving me this error Err http://bd.archive.ubuntu.com raring Release.gpg Could not connect to bd.archive.ubuntu.com:80 (116.193.170.18), connection timed out Err http://bd.archive.ubuntu.com raring-updates Release.gpg Unable to connect to bd.archive.ubuntu.com:http: Err http://bd.archive.ubuntu.com raring-backports Release.gpg Unable to connect to bd.archive.ubuntu.com:http: Reading package lists... Done W: Failed to fetch http://bd.archive.ubuntu.com/ubuntu/dists/raring/Release.gpg Could not connect to bd.archive.ubuntu.com:80 (116.193.170.18), connection timed out W: Failed to fetch http://bd.archive.ubuntu.com/ubuntu/dists/raring-updates/Release.gpg Unable to connect to bd.archive.ubuntu.com:http: W: Failed to fetch http://bd.archive.ubuntu.com/ubuntu/dists/raring-backports/Release.gpg Unable to connect to bd.archive.ubuntu.com:http: W: Some index files failed to download. They have been ignored, or old ones used instead. I am not a Ubuntu master but I can understand this is not a computer error. Any clues on how to fix it?", "Extract date from a variable in a different format Let me explain you the problem $ date +%c -d \"$d\" Tue 31 Dec 2013 01:13:06 PM CET $ date +'Today is %F' -d \"$d\" Today is 2013-12-31 This solution corresponds to current date. But I have one variable which stores date other than current date $Prev_date=\"Wed Dec 25 06:35:02 EST 2013\" I am looking for solution to read this date as 2013-12-25 and store it in a variable. I have tried this: a=`date --date=$Prev_date '+%y/%m/d'` echo $a It's giving this error: date: illegal option -- date=Wed usage: date [-u] mmddHHMM[[cc]yy][.SS] date [-u] [+format] date -a [-]sss[.fff]", "What should happen if a logo I made is similar to another?", "Is it possible to trade Pokemon from the 1st generation games to the most recent ones? I know that you can trade Pokemon between games of the same generation (Gold/Silver, Ruby/Sapphire) and even trade between 1st gen and 2nd gen. However, I haven't been able to find a way to trade Pokemon so that I can play with my 1st generation Pokemon in HeartGold, for instance. If it is possible, how many steps would it take and what equipment would I need?", "How to mount EXT4 disk on 10.15? Since I have osxfuse installed it would be nice if I could use it. There are a (heavily) outdated here, saying that it is not . Is this still the case?", "Ubuntu 20.04 brightness adjust not working I am unable to adjust brightness levels through Gnome. I had the same issue with 18.04 but it was resolved there (honestly, I can't remember how). lspci|grep VGA 00:02.0 VGA compatible controller: Intel Corporation Core Processor Integrated Graphics Controller (rev 18) xrandr --output LVDS-1 --brightness 0.95 &lt;-- this works through the terminal excerpt from /etc/default/grub GRUB_CMDLINE_LINUX_DEFAULT=\"quiet splash acpi_backlight=vendor\" Thank you in advance.", "We've tried this a few times. First time we used an old ceramic container and it started sheding on the inside and ruined it. Next time we used a new metal garbage can with one of those super sized 10 gallon zip lock bags as a liner. It went rank very quickly. This could have been due to our packing though. Before we get into this again, what is you recommendation for a good container? I hate the thought of plastics but it seems it might just be the best choice as long as it's made for food storage.", "Get OS-level system information", "If we multiply 2 number and take the mod with prime this is equivalent to first taking mod with the prime of individual number and then multiplying the result and again taking mod. $$ ab\\bmod p = ((a\\bmod p)(b\\bmod p))\\bmod p$$ does there exist any proof for this? Does it work for composite moduli too? Then I can use the Chinese remainder Theorem to calculate the result does there any other way apart from Chinese remainder Theorem to solve the problem?", "Traveling to Ireland with German National visa I am a student at the University of Stuttgart, Germany and I have a 1 year national visa for Germany and now as my holidays are ahead I was looking if my German visa is sufficient to travel to Ireland for some 10 days. I am a citizen of Republic of Armenia.", "Should moderators be allowed to decline flags on their own comments? I think I just witnessed a moderator decline a flag raised on his own comment. (I'm hesitant to discuss specifics unless I have to, as I don't mean to put anyone in a negative light.) Since there are at least 2 other moderators per site, I'm not sure this should be allowed—I feel that either only uninvolved moderator(s) should be able to view and handle flags on co-moderators' posts, or moderators should be able to view all flags, but a flagged moderator should not be allowed to decline a flag against him- or herself. I have no personal issue with this moderator. I just felt in this case that there was truth in both sides (the moderator's as well as the flagging user's), and sought a win-win solution, i.e. by improving the disputed answer. Coming back an hour later to see that the moderator unilaterally declined the user's flag—that didn't seem fair to the user... I am making some assumptions based on the \"Last Seen\" stat in the moderator tools, so if I'm simply mistaken on what happened, I apologize in advance.", "Prevent malicious bots from posting spam", "Considering phrases of the form \"I left [the] X\", what causes some words to need a \"the\" before them, while it sounds awkward with others? Needs \"the\": I left the office I left the bank I left the house I left the courthouse Awkward with \"the\": I left work I left social media I left New York Either way works: I left [the] school I left [the] church", "When I run the logistic regression, two independent variables have VIF values greater than 10 like 13 or so. Logistic regression is the one I will use to measure the overall change in the dependent variable with one incremental changes in every each independent variable. However, when I run the linear regression model version on my same data, the VIF values I get from all the independent variables are either slightly greater than 1 or around 5 or 6. Besides, all the coefficients are highly significant all below 0.01. If so, is it safe to use my logistic regression model to find out the incremental effect of every each independent variable without dropping out any independent variables? If my purpose is to find an incremental effect of every each independent variable on the overall dependent value in a logistic regression model, is multicolinearity an important problem to consider? Can I ignore it? If my p-values are all less than 0.01 which is the same indicator as t-value, will I still need to worry about colinearity issue even though my VIF scores for two variables are around 13-14? Based on what you said, if p-value is safe enough, will this be still a problem? I am also referring to the following website comment: So, in sum, my ultimate goal is to use the final output from the logistic regression model generated from the independent variables and one binary dependent variable. If so, do you think I can ignore the multicolinearity problem?", "Vortex in liquid collects particles in center", "If $|A| > \\frac{|G|}{2} $ then $AA = G $ I'v found this proposition. If $G$ is a finite group , $ A \\subset G $ a subset and $|A| &gt; \\frac{|G|}{2} $ then $AA = G $. Why this is true ?", "So, my friend just implemented a bunch of new mods into his SMP server, which meant a host of new commands to play with. I thought I'd give the /mobspawn command a few goes, and see what I could achieve. So I headed off to the server's jail (I forget why this particular location compelled me), and gave it a few spins. I seem to have made a bit of an error in judgement. What can I do to get rid of this mess? Is there a command or some other technique I can use to clear out any mobs in my immediate vicinity?", "Quotient ring of Gaussian integers $\\mathbb{Z}[i]/(a+bi)$ when $a$ and $b$ are NOT coprime The isomorphism $\\mathbb{Z}[i]/(a+bi) \\cong \\Bbb Z/(a^2+b^2)\\Bbb Z$ is , when the integers $a$ and $b$ are coprime. But what happens when they are not coprime, say $(a,b)=d&gt;1$? — For instance if $p$ is prime (which is not coprime with $0$) then $$\\mathbb{Z}[i]/(p) \\cong \\mathbb{F}_p[X]/(X^2+1) \\cong \\begin{cases} \\mathbb{F}_{p^2} &amp;\\text{if } p \\equiv 3 \\pmod 4\\\\ \\mathbb{F}_{p} \\times \\mathbb{F}_{p} &amp;\\text{if } p \\equiv 1 \\pmod 4 \\end{cases}$$ (because $-1$ is a square mod $p$ iff $(-1)^{(p-1)/2}=1$). — More generally, if $n=p_1^{r_1} \\cdots p_m^{r_m} \\in \\Bbb N$, then each pair of integers $p_j^{r_j}$ are coprime, so that by CRT we get $$\\mathbb{Z}[i]/(n) \\cong \\mathbb{Z}[i]/(p_1^{r_1}) \\times \\cdots \\times \\mathbb{Z}[i]/(p_m^{r_m})$$ I was not sure how to find the structure of $\\mathbb{Z}[i]/(p^{r}) \\cong (\\Bbb Z/p^r \\Bbb Z)[X] \\,/\\, (X^2+1)$ when $p$ is prime and $r&gt;1$. — Even more generally, in order to determine the structure of $\\mathbb{Z}[i]/(a+bi)$ with $a+bi=d(x+iy)$ and $(x,y)=1$, we could try to use the CRT, provided that $d$ is coprime with $x+iy$ in $\\Bbb Z[i]$. But this is not always true: for $d=13$ and $x+iy=2+3i$, we can't find Gauss integers $u$ and $v$ such that $du + (x+iy)v=1$, because this would mean that $(2+3i)[(2-3i)u+v]=1$, i.e. $2+3i$ is a unit in $\\Bbb Z[i]$ which is not because its norm is $13 \\neq ±1$. — I was not able to go further. I recall that my general question is to known what $\\mathbb{Z}[i]/(a+bi)$ is isomorphic to, when $a$ and $b$ are integers which are not coprime (for instance $a=p^r,b=0$ or $d=(a,b) = a^2+b^2&gt;1$). Thank you for your help!" ]

[ "Completeness and Incompleteness", "It would be nice to for . As it is, SE kind of stands out (in a not cool way):", "Prove that a set in $\\mathbb R^3$ is not an algebraic set I want to prove that the set $\\{(\\cos(t),\\sin(t),t)\\in A^3(\\mathbb R); t\\in \\mathbb R \\}$ is not an algebraic set. I already proved that the set $\\{(\\sin(t),t)\\in A^2(\\mathbb R);t\\in \\mathbb R \\}$ is not algebraic but the method that I used doesn't seems to be general.", "If $\\gcd(a,b)=1$, then there exists integers $x$ and $y$ such that $xa + yb = 1$ Did not find this from this website... If $$ \\gcd(a,b)=1,$$ then there exists integers $x$ and $y$ such that $$xa+yb=1.$$ Now, the tip is to use particular corollary, that states: The class $[m]_{n}$ generates $\\mathbb{Z}/n\\mathbb{Z}\\Leftrightarrow \\gcd(m,n)=1.$ I am totally lost with the corollary. Let's assume that $\\gcd(m,n)=1$. Then, $[m]_{n}$ generates $\\mathbb{Z}/n\\mathbb{Z}$. OK! Then what? There is also follow up, where I have to prove the converse. I am familiar with Bezout's lemma.", "I was able to read and write NTFS filesystems normally in Mountain Lion, but after the upgrade this stopped to work. I installed ntfs-3g and fuse4x using homebrew in Mountain Lion and followed the instructions displayed by homebrew to finish the installation of fuse4x kernel extension. To try to solve this problem I removed ntfs-3g, fuse4x and fuse4x-kext and reinstalled them. But this didn't solve my problem. Does anyone know how to solve this? Thanks.", "What do the plus and minus signs mean in Objective-C next to a method?", "Consider this conversation: John: I am giving free chess lessons. Mary: Nice! You’re a true teacher. John: How so? Mary: A true teacher imparts knowledge without a price tag. John: But what if teaching is his only source of income? Would he not be a “true” teacher then? Mark (in response to the question above): You clearly mentioned “free chess lesson”. I don’t see how Mark’s comment adds anything to the discussion or makes sense in the current discussion. It is “redundant” — that’s one word for it — but is there a more fitting word?", "I have six upvotes for the one question with no intervening history. They have been summarised into two groups - one with 4 events and one with 2 events. However, when you expand either, both show all 6 events. Minor I know, just letting you know.", "Let $X$ be an arbitrary random variable takes values in $\\{0,1,2,...,10\\}$. What are the minimum and maximum values of variance of random variable $X$?", "After T-2, why not send back another T-800?", "Can I mix MySQL APIs in PHP?", "How do I complete \"Find the Bitizen\"? In tiny Death Star, Palpatine has given me the mission \"Find the Bitizen\" with the text \"Working for tips is acceptable. Find 1 Bitizen(s).\" I assumed I had to wait for one of the events where you have to find a \"rebel scum\" and tap on it to get rid of. One of those events finally popped up but it did not complete the mission. How do I complete this mission?", "What level is a spell if you cast it without expending a spell slot? There are ways to cast spells without expending a spell slot such as: Master Transmuter (PHB 119): Restore Life. You cast the raise dead spell on a creature you touch with the transmuter’s stone, without expending a spell slot or needing to have the spell in your spellbook. Armor of Shadows (PHB 110): You can cast mage armor on yourself at will, without expending a spell slot or material components. Whispers of the Grave (PHB 111): You can cast speak with dead at will, without expending a spell slot. See also: Channel Divinity: Read Thoughts (PHB 59-60), Mystic Arcanum (PHB 108), Beast Speech (PHB 110), Chains of Carceri (PHB 110), Eldritch Sight (PHB 110), Fiendish Vigor (PHB 111), Mask of Many Faces (PHB 111), Master of Myriad Forms (PHB 111), Misty Visions (PHB 111), Otherwordly Leap (PHB 111), Signature Spells (PHB 115), Spell Mastery (PHB 115), Shapechanger (PHB 119), Boon of Spell Mastery (DMG 232) and Boon of Spell Recall (DMG 232). What level are these spells if you cast them without expending a spell slot?", "Fantasy/scifi combo - band of travelers who must get from \"sphere\" or domain to domain - each geographic area is ruled by a magician - it turns out later these are people who are unwittingly tapping into the computer grid they all live on to alter their own reality?", "Bit error rate calculation for LIN protocol I am having this microcontroller - I am using an 8MHz external clock. I want to calculate the Bit error rate of my LIN Communication. My LIN Communication Baud rate is 19.2kbps. My questions : Can I use the LPUART Module in the Mirocontroller for the LIN Communication? How to find the Bit error rate for the LIN Protocol communication for my baud rate of 19.2kbps and external clock of 8MHz. I found this below from the reference manual. But not sure, how to calculate the Bit error rate from this. How to calculate the SBR Register value, OSR and the LPUART ASYNCH Module clock? Please help", "3 input XNOR gate operation", "\"It's cold today\" -- what term do linguists use to call \"it\" when it's used as the subject of a sentence, but has no real antecedent?", "Ubuntu 18.04 bond with netplan duplicate MAC address after cloning", "\"strlen(s1) - strlen(s2)\" is never less than zero", "Would you please explain the difference between these two sentences? Spain ceded (or gave) Puerto Rico to the United States. Since then, Puerto Rico has been a U.S. territory. Spain ceded(or gave) Puerto Rico to the United States. Since then, Puerto Rico was a U.S. territory. I am stuck between 'has been' and 'was' in the above sentences." ]

[ "Are there systems in classical mechanics that are provably non-deterministic?", "Can Blender render animated gifs?", "The standard files/tools that report memory seem to have different formats on different Linux distributions. For example, on Arch and Ubuntu. Arch $ free total used free shared buff/cache available Mem: 8169312 3870392 2648348 97884 1650572 4110336 Swap: 16777212 389588 16387624 $ head /proc/meminfo MemTotal: 8169312 kB MemFree: 2625668 kB MemAvailable: 4088520 kB Buffers: 239688 kB Cached: 1224520 kB SwapCached: 17452 kB Active: 4074548 kB Inactive: 1035716 kB Active(anon): 3247948 kB Inactive(anon): 497684 kB Ubuntu $ free total used free shared buffers cached Mem: 80642828 69076080 11566748 3063796 150688 58358264 -/+ buffers/cache: 10567128 70075700 Swap: 20971516 5828472 15143044 $ head /proc/meminfo MemTotal: 80642828 kB MemFree: 11565936 kB Buffers: 150688 kB Cached: 58358264 kB SwapCached: 2173912 kB Active: 27305364 kB Inactive: 40004480 kB Active(anon): 7584320 kB Inactive(anon): 4280400 kB Active(file): 19721044 kB So, how can I portably (across Linux distros only) and reliably get the amount of memory—excluding swap—that is available for my software to use at a particular time? Presumably that's what's shown as \"available\" and \"MemAvailable\" in the output of free and cat /proc/meminfo in Arch but how do I get the same in Ubuntu or another distribution?", "How can I learn the basics of SharePoint 2013 in a few days? I have very little knowledge of SharePoint, and want to learn about SharePoint 2013. Most of the resources that I've found are either about what's new in 2013, or they have a bunch of links to SharePoint 2010. I also don't have the time to read a thousand page book. A hundred or so would be fine. Can anyone recommend a resource (site / book / video / tutorial) for a beginner to learn the basics of SharePoint 2013 in a few days? I've downloaded a Kindle book, \"Getting Started With SharePoint 2013.\" It's perfect for absolute beginners, who just want to know how to upload &amp; download documents, but I'm looking for more than that.", "Graphing the amount of time a function takes", "How could I write my name, for example, to look like the \\LaTeX logo? How could I write my name, for example, in a \\LaTeX style? It is just interesting, as in Google all other things pop up when I try to search for an answer!", "How many days a year is a U.S. citizen allowed to stay in Morocco? I arrived in Morocco in October of 2014 and renewed my visa by traveling to Spain by ship for a day and getting my passport stamped again in January of 2015. My question is, am I allowed to leave the country and repeat this process this year by traveling again to another country, other than my own in order to return to Morocco for another 90 days? And if so, how many times a year is this allowed? I have read 180 days on some websites but there is not any clear answers anywhere about this that I can find.", "How can a company use money from stock investors when they are constantly being bought and sold? I am interested in the mechanisms which a company can use the money that investors give them when they buy a public stock since they are being bought and sold constantly. How can a company spend other people's assets when the shareholders still own their stocks and they still retain a liquid value? To me it seems like stocks are a case of \"having your cake and eating it too\".", "PDOException “could not find driver”", "There are a lot of poorly drawn schematics here. A few times people have actually asked for critiques of their schematics. This question is intended as a single repository on schematic drawing rules and guidelines can point people to. The question is What are the rules and guidelines for drawing good schematics? Note: This is about schematics themselves, not about the circuits they represent.", "Why did the gamma ray burst from GW170817 lag two seconds behind the gravitational wave? , reporting on the announcement of gravitational wave GW170817, explained that for the first time we could identify the precise source of a gravitational wave because we also observed the event in the electromagnetic spectrum. It notes however that the gamma ray burst detected by the FERMI space telescope was observed nearly two seconds later than the gravitational wave. Did the gamma ray burst actually arrive at Earth two seconds after the gravitational wave, or is this time delay just some kind of observational artefact? If the delay is real, what is its cause? Is the delay due to the gamma ray burst somehow being slowed, or was it 'emitted' at a different time in the merger event? What does a delay even mean when the gravitational wave was detected for over 100 seconds? Is it a delay from peak GW to peak gamma ray?", "Is there a *simple* example showing that uncorrelated random variables need not be independent?", "Batch Requests/sec reported by DMV millions of times larger than Activity Monitor I have verified through SQL Server Profiler that my request per-second are around 30 request/s as is corroborated by SSMS Activity Monitor but sys.dm_os_performance_counters is reporting hundreds of millions/s. Any idea what might be causing this gross discrepancy? Query: SELECT RTrim(LTrim(object_name)) as object_name, RTrim(LTrim(counter_name)) as counter_name, cntr_value FROM sys.dm_os_performance_counters WHERE instance_name IN ('', '_Total') and counter_name IN ( N'Batch Requests/sec' , N'SQL Compilations/sec' , N'SQL Re-Compilations/sec' , N'Transactions/sec') Results: object_name counter_name cntr_value SQLServer:Databases Transactions/sec 191721399 SQLServer:SQL Statistics Batch Requests/sec 242955426 SQLServer:SQL Statistics SQL Compilations/sec 42048371 SQLServer:SQL Statistics SQL Re-Compilations/sec 1200947", "Why does Sass change the format of my colors?", "Why do C# multidimensional arrays not implement IEnumerable?", "I am a Indian citizen holding a work residence permit from Norway for two years. I want to make some trips in the rest of the Schengen area. I am planning my first trip to Portugal on 22/08/18 till 26/08/18, a second trip to Italy from 22/11/18 to 27/11/18, and again to Portugal from 06/02/19 to 16/02/19. I will stay permanently inside Norway after each trip to other Schengen countries. How does the 90/180 rule work in this case? Am I allowed to make all those trips while holding my residence permit in Norway? Can you let me know if I'm exceeding the 90-day limit with these trips?", "Zero probability and impossibility I read a comment under : There are plenty of events that can occur that have zero probability. This reminds me that I have seen similar saying before elsewhere, and have never been able to make sense out of it. So I was wondering if zero probability and impossibility mean the same? if an event with zero probability doesn't mean that the event is impossible to occur, how probability theory represents/describes impossibility? Thanks and regards!", "Rotate touchscreen and disable the touchpad on Yoga 2 Pro in rotated mode On my Lenovo Yoga 2 pro I installed Ubuntu 14.04 32bit and kept the installed Windows 8 on another partition. In Windows, When you turn it into tablet mode, the keyboard and touchpad turns off so you don't accidently click on it at the back of the \"tablet\". In ubuntu 14.04 only the keyboard turns off, but the touchpad stays active. Not even the Fn+F6 combination doesn't turn it off. So far I can only disable it with synclient TouchpadOff=1 (and re-enable with 0) I tried xev to get the keycode for Fn+F6 but pressing this combo generates no output. Turning the monitor to the back neither. How can I disable the touchpad automatically when I rotate or turn the monitor on the back, and re-enable the Fn+F6 Hotkey? UPDATE: After some weeks sudo apt-get upgrade Fn+F6 is working now, so there is only the question how to rotate the screen and how to disable the touchpad automatically when rotating the screen.", "When looking at my objects in 3d view I'm seeing a gray cone that seems to be hiding other objects. Can anyone help me turn this off and explain what it is please. Screenshots attached.", "Scale a div to fit in window but preserve aspect ratio" ]

[ "How do I connect Android devices to a WiFi AP and mobile data network simultaneously?", "I am an Indian passport holder travelling from China to India via Kuala Lumpur, on Air Asia tickets bought separately. The layover is 4 hours and 30 minutes. Do I need a transit visa?", "How does quantization solve the ultraviolet catastrophe?", "What logical fallacy considers a personal experience to be common place While my wife and I were discussing the news a few days ago I stated that an argument expressed (in a news article, not by my wife) was a fallacy -- but I've been unable to put a name to it. Basically, it is when a person experiences some experience (personally or thru acquaintance), and thus considers it a common experience because they have experienced it.", "limsup of intersection of events as a subset of intersection of limsups", "How are constraint forces represented in Lagrangian mechanics?", "Unicode Processing in C++ What is the best practice of Unicode processing in C++?", "How to prevent a scrollview from scrolling to a webview after data is loaded?", "Error message in my excel formula", "Run a shell script as another user that has no password I would like to run a script from the main ubuntu shell as a different user that has no password. I have full sudo privileges, so I tried this: sudo su -c \"Your command right here\" -s /bin/sh otheruser Then I have to enter my password, but I am not sure if that script is now really running under that user. How can I confirm that the script is really running under that user now?", "strptime() equivalent on Windows? Is there a good equivalent implementation of strptime() available for Windows? Unfortunately, this POSIX function does not appear to be available. - summary: it converts a text string such as \"MM-DD-YYYY HH:MM:SS\" into a tm struct, the opposite of strftime().", "Is it possible to convert virtual machines to physical environments?", "Using Illustrator CS6 to create shape out of multiple paths", "Moving app to production mode in Symfony 2", "What does ;; do in sh?", "What is the difference between \"till\" and \"until\"? What is the difference between till and until? When to use till or until? Please explain with examples.", "I have scene that looks like this: And I want to add volumetric lighting to it so that light forms a rays of light when it go through the trees like on this example that I found in youtube: But the problem is that all of these tutorials show how to make this lighting coming from windows, but when I try to replicate it in my forest scene it looks like big ugly fog with cubical shape. Also the light is coming from the back of the camera (as you can see) and there are some spots that needs this special lighting (like places where light goes through trees) and some that don't (like big bright are on the bottom left corner) so I can't just add a giant cube to all of the scene.", "Let's get rid of the 10K flag queue are pretty cool... You get a birds-eye view of activity on the site, a &quot;dashboard&quot; view of what's happening. Some of the individual tools haven't scaled particularly well with Stack Overflow's growth, but the concept behind them is still sound: we trust you to enough to be a bee watcher now. ...and then there's . What a let-down! Once upon a time, this queue contained spam and offensive flags, which one might reasonably assume were important enough to put in front of the more trusted members of the site. Re-flagging them brought them that much closer to deletion, while editing them offered salvation to some hapless author. Nowadays, it's a bunch of Not an Answer flags and a smattering of assorted cruft. 10K users can't even vote to delete these; only 20K users have that privilege. Re-flagging them does nothing but increase their priority in the moderator flag queue, where they frequently outrank more pressing issues; has . Also, it's , and the behavior has diverged far enough from that of the moderator flag queue on which it is based that it has become an active hindrance to further development of the tooling there. Worst of all, we have that's available to anyone with the editing privilege. It even has logic built in to prioritize answers likely to be deleted for users with . It's like we gave you a car for your 10th birthday, and then replaced it with a rusty bicycle when you turned 16. It was a nice idea, but it has outlived its usefulness. Proposed changes The /tools/flagged route goes away. Period. No replacement. The rest of the 10K tools stick around as informational pages. Not an Answer flags go into /review/low-quality, . Then we beef up the Low Quality review process to make better use of more experienced reviewers and solve this whole &quot;declined / helpful / disputed&quot; flag debate once and for all: Effective # of reviews required == ReviewsRequired + # of applicable flags (where ReviewsRequired is 2 on Stack Overflow, 1 everywhere else). So 1 VLQ or NAA flag means EffectiveReviewsRequired=3. LQ tasks are not dequeued until one of the following conditions is met: Post is edited from within review. Outcome: flags are marked &quot;helpful&quot; (current behavior). Post accumulates 3 Delete votes (can only happen when post scores &lt;= 0 and reviewers have &gt;= 20K rep). Outcome: post is deleted, flags are marked &quot;helpful&quot;. Task accumulates EffectiveReviewsRequired &quot;Looks Good&quot; reviews. Outcome: if the number of (Recommend)Delete reviews is &gt;= the number of Looks Good reviews, mark flags &quot;disputed&quot; and raise DisputedLowQuality mod flag. Otherwise, mark flags &quot;declined&quot;. Task accumulates 6* RecommendDelete + Delete reviews. Outcome: mark flags &quot;helpful&quot;. If the post scores &gt; 0 then raise DisputedLowQuality mod flag, else just delete post (current behavior). As under the current system, flags on posts that've already completed one full review cycle without being deleted should skip /review and go directly into the mod queue. End result Flags get handled faster, more accurately, and with less wasted effort from 10K reviewers. Moderators are free to focus on situations that can't be handled by the community - the ! Developers are free to make enhancements to the moderator tooling without having to work around 10K user restrictions. Questions Am I forgetting anything here? I haven't really spent much time in the 10K flag queue since back when it was filled with spam flags and therefore useful - is there a use-case that you depend on that would be lost with its removal? Post 'em below. *: on Stack Overflow, only .", "Getting from Denver Amtrak to Fort Collins The eastbound Amtrak arrives Denver 6:38 PM (18:38). How can I get to Fort Collins from there? The runs from Denver International Airport to Fort Collins, but the airport is 40 km from the Amtrak station, so that's a major detour, that would mean taking bus FX from Market Street Station 7:18 PM, arriving at the airport at 8:27 PM, then the super shuttle 9:05 PM, arriving Fort Collins CSU at 10:55 PM; almost 4 hours after departing from Denver. Greyhound Lines appears to have a bus departing 12:45 AM, arriving 02:00 AM — although probably as quick as it gets, this is not exactly a comfortable time. RTD Denver has transportation to Longmont and from Longmont to Fort Collins, but appears to depart 7:05 PM — so I won't make it there when arriving by Amtrak. A taxi would cost an estimated . Is there any other way to get to Fort Collins when arriving by the eastbound Amtrak, any way that I've missed?", "Smaug first appeared in TA 2770 as a mature Fire-drake. I'm not sure if there are canonical sources which say his age or maturity, but he must have been quite large and quite old at the time in order to destroy the city of Dale and capture Erebor. Since it is safe to assume that Smaug would have been attacking towns and stealing all of the gold and jewels he could get his claws on for most of his life, then he must have amassed a huge fortune prior to taking residence at Erebor. How did he transport his existing horde to Erebor? It seems unlikely that he would have simply abandoned all of his treasure that he had previously accumulated. EDIT: It has been established that Smaug was not a mature drake at the time of his appearance. However, he may have already had a small horde (compared to Erebor)." ]

[ "What is the difference between $* and $@?", "Pushforward of inverse map at the identity? Let $G$ be a Lie group and $i:G \\rightarrow G$ denote the inversion map $i(x) = x^{-1}$. (Notation: $f_*$ is the pushforward map $F_*:T_pG \\rightarrow T_{i(p)}G$ which takes $(F_{*}X)(f)=X(f\\circ F)$ and $X$ is a tangent vector, $X\\in T_pG$.) I wish to show that $i_{*}:T_{e}G\\rightarrow T_{e}G$ is given by $i_{*}(X)=-X$ As a first step, it is trivial to prove that $i_*$ is an involution as $\\mbox{Id}_{*}=(i\\circ i)_{*}=i_{*}\\circ i_{*}$ but I can't seem to make any further progress. Any help would be appreciated.", "Why every polynomial over the algebraic numbers $F$ splits over $F$?", "How to test apex classes with Pagereference? I'm struggling to test a class with pagereference. Following is the class... public with sharing class redirectOrderPartner{ public String currentRecordId {get;set;} public orders__c orderId {get;set;} public redirectOrderPartner(ApexPages.StandardController controller) { } Public Pagereference go(){ currentRecordId = ApexPages.CurrentPage().getparameters().get('orderid'); system.debug('---currentRecordId ---'+currentRecordId ); orderId = [select id from orders__c where name =: currentRecordId limit 1]; system.debug('---orderid---'+orderId); PageReference pageRef = new PageReference('/apex/OrderTrackingClass?id='+orderId.id); pageRef.setRedirect(true); return pageRef; } } Following is what I tried.... @isTest public class redirectOrderPartner_TEST { static testMethod void Test(){ Account acc = new Account(Name='ABC Corp.'); insert acc; orders__c tempOrder = new orders__c(name = '0001234567', account__c = acc.id ); insert tempOrder; Test.startTest(); PageReference pageRef = Page.redirectOrderPartner; Test.setCurrentPage(pageRef); ApexPages.Standardcontroller sc = new ApexPages.Standardcontroller(tempOrder); ApexPages.currentPage().getParameters().put('Id',tempOrder.name); PW_redirectOrderPartner ec = new redirectOrderPartner(sc); ec.go(); Test.stopTest(); } } I get the following error message on testing.. System.QueryException: List has no rows for assignment to SObject What am I missing? Thanks", "Shorten title on each beamer slide In a beamer presentation the title is long but ok for the first slide. The problem is that when the title appears below on each slide it is very long and I would like to use here some sort of running or shorter title, how can this be done?", "why does fdisk add one additional sector when creating partitions? I'm playing around with fdisk and I tried to create a partition on an empty USB drive. Here's how that went: Command (m for help): n Partition number (1-128, default 1): 1 First sector (34-61187102, default 2048): 2048 Last sector, +/-sectors or +/-size{K,M,G,T,P} (2048-61187102, default 61187102): +30000000 Created a new partition 1 of type 'Linux filesystem' and of size 14,3 GiB. so just one partition with 30 million sectors. However, when I check how many sectors it contains I get: I'm checking with a different program and I see again that additional sector: Sorry for the pettiness :) I'm learning.", "How can I get file extensions with JavaScript?", "Parse a Json Array in to a class in c#", "How to use a decimal range() step value?", "cardinality of all real sequences I was wondering what the cardinality of the set of all real sequences is. A random search through this site says that it is equal to the cardinality of the real numbers. This is very surprising to me, since the cardinality of all rational sequences is the same as the cardinality of reals, and it seemed fairly intuitive to me that if cardinality of a set $A$ is strictly greater than the cardinality of the set $B$, then cardinality of $A^{\\mathbb{N}}$ should be strictly greater than cardinality of $B^{\\mathbb{N}}$. It turns out to be false. Some technical answers have appeared in this forum elsewhere but I do not understand them. As I am not an expert in this topic, could some one explain me in simple terms why this is happening? Also is the cardinality of all functions from reals to reals also the same as the cardinality of reals?", "Relation between magnetic moment and angular momentum -- classic theory How do I prove the relation between the vectors of magnetic moment $\\vec\\mu$ and angular momentum $\\vec L$, $$\\vec\\mu=\\gamma\\vec L$$ ? Many text books and lecture notes about the principles of magnetism show the relation of $\\mu$ and $L$ as scalars only and then just state that the relation holds also for the vectors. An example: $$\\mu=I\\cdot A = \\frac{q}{t}\\pi r^2 = \\frac{qv}{2\\pi rm}m\\pi r^2$$ ($I=q/t$: current, $A$: area of a loop, $q$ charge, $t=2\\pi r/v$: time of 1 rotation, $v$: velocity of particle, $m$: mass ) The angular momentum is $\\vec L = \\vec r\\times\\vec p$ or $L=mrv$ and therefore $$\\Rightarrow \\mu = {\\frac{q}{2m}} L = \\gamma L.$$ Why is this also true for the vectors? Is there a general explication by classical physics without the need of quantum theory?", "In the android app, looking at bounty details using the i button, the bounty reasons are not shown: The bounty message can provide important information as to the setter's requirements (who may not be the OP and therefore does not wish to edit the question to do so).", "Dust on Sensor After Many Cleanings DSLR", "Show that there is no solution to the congruence $x^2\\equiv3\\bmod5$. I'm not sure if the fact that the only numbers divisible by $5$ are those ending in $0$ or $5$ will help&hellip;", "Setting a document in MS Word-12pt (12bp) Warning If you're looking for advice how to make your document look like it's been written in Word, this is most likely not the question you're looking for. This question is mostly of theoretical nature, as it results in tiny differences, which will most likely not be noticed by someone who doesn't allow the use of LaTeX. Questions that might be more helpful for this matter are: Question I learned that MS Word uses a slightly different version of the unit \"point\" (pt) than TeX does: The 12 point of Word will be PostScript point, which in TeX would be called 12bp. A TeX pt is slightly smaller: it's 1/72.27 inch, while a bp/PostScript point is 1/72 inch. See also ( in ) I'm writing a paper that would usually be expected to be \"typeset\" in MS Word, thus I want to use the same font size as Word would. How do I set a document e.g. in the \"12pt\" font size that MS Word would use? In case it matters, I'm using the article document class, Latin Modern (lmodern) as a font with the T1 font encoding and compile with pdfLaTeX, but input on different set-ups is more than welcome.", "Just installed Ubuntu for the first time... Is there any simple way to browse installed programs? On Mac there is the Applications top-level folder... here I see Desktop, Documents, Downloads etc but no Apps? That'd be a good idea, no? (is there some way to create this myself?) On Windows there is the Start menu... Here it seems like I have to click the 'Dash Home' and then I can see 'Recent Apps' ... I can search for them (I'd rather not) ...or I can click the ruler/pencil icon at the bottom and see 'Recent Apps' and click to expand 'Installed Apps' ...ok that's all of them - is it possible to get a straight list view instead of the hard-to-scan wrapped rows? Also, is there any way to get rid of the pointless random selection of 'Apps available for download' at the bottom?", "I've lost my original power adapter, and I can't find the proper one in any of the stores currently available. I've HP Compaq 6730b, and as per it outputs 18.5V 3.5A. However, I've found an older power adapter I have which outputs 19.5V 4.62 A. So, my question is: how much of a difference between those two it really is, and more importantly, how much of a risk would it be if I tried the power adapter I already have. P.S. I know pretty much nothing about electricity/electronics.", "What should I do when my neural network doesn't generalize well? I'm training a neural network and the training loss decreases, but the validation loss doesn't, or it decreases much less than what I would expect, based on references or experiments with very similar architectures and data. How can I fix this? As for question to which this question is inspired, the question is intentionally left general so that other questions about how to reduce the generalization error of a neural network down to a level which has been proved to be attainable, can be closed as duplicates of this one. See also dedicated thread on Meta:", "How did Luke know where to land on Dagobah?", "How do I create a dynamic key to be added to a JavaScript object variable" ]

[ "How to get client's IP address using JavaScript? I need to somehow retrieve the client's IP address using JavaScript; no server side code, not even SSI. However, I'm not against using a free 3rd party script/service.", "Home Electric Panel Questions I’m having a pool put in and the pool guys said they need a 20 amp breaker for the pool equipment. My outside panel says 100 amps (see picture). But my panel inside adds up well over 100 amps. Is this normal? The breakers never trip even with the dryer, AC, and other appliances running.", "Let's get rid of the 10K flag queue are pretty cool... You get a birds-eye view of activity on the site, a &quot;dashboard&quot; view of what's happening. Some of the individual tools haven't scaled particularly well with Stack Overflow's growth, but the concept behind them is still sound: we trust you to enough to be a bee watcher now. ...and then there's . What a let-down! Once upon a time, this queue contained spam and offensive flags, which one might reasonably assume were important enough to put in front of the more trusted members of the site. Re-flagging them brought them that much closer to deletion, while editing them offered salvation to some hapless author. Nowadays, it's a bunch of Not an Answer flags and a smattering of assorted cruft. 10K users can't even vote to delete these; only 20K users have that privilege. Re-flagging them does nothing but increase their priority in the moderator flag queue, where they frequently outrank more pressing issues; has . Also, it's , and the behavior has diverged far enough from that of the moderator flag queue on which it is based that it has become an active hindrance to further development of the tooling there. Worst of all, we have that's available to anyone with the editing privilege. It even has logic built in to prioritize answers likely to be deleted for users with . It's like we gave you a car for your 10th birthday, and then replaced it with a rusty bicycle when you turned 16. It was a nice idea, but it has outlived its usefulness. Proposed changes The /tools/flagged route goes away. Period. No replacement. The rest of the 10K tools stick around as informational pages. Not an Answer flags go into /review/low-quality, . Then we beef up the Low Quality review process to make better use of more experienced reviewers and solve this whole &quot;declined / helpful / disputed&quot; flag debate once and for all: Effective # of reviews required == ReviewsRequired + # of applicable flags (where ReviewsRequired is 2 on Stack Overflow, 1 everywhere else). So 1 VLQ or NAA flag means EffectiveReviewsRequired=3. LQ tasks are not dequeued until one of the following conditions is met: Post is edited from within review. Outcome: flags are marked &quot;helpful&quot; (current behavior). Post accumulates 3 Delete votes (can only happen when post scores &lt;= 0 and reviewers have &gt;= 20K rep). Outcome: post is deleted, flags are marked &quot;helpful&quot;. Task accumulates EffectiveReviewsRequired &quot;Looks Good&quot; reviews. Outcome: if the number of (Recommend)Delete reviews is &gt;= the number of Looks Good reviews, mark flags &quot;disputed&quot; and raise DisputedLowQuality mod flag. Otherwise, mark flags &quot;declined&quot;. Task accumulates 6* RecommendDelete + Delete reviews. Outcome: mark flags &quot;helpful&quot;. If the post scores &gt; 0 then raise DisputedLowQuality mod flag, else just delete post (current behavior). As under the current system, flags on posts that've already completed one full review cycle without being deleted should skip /review and go directly into the mod queue. End result Flags get handled faster, more accurately, and with less wasted effort from 10K reviewers. Moderators are free to focus on situations that can't be handled by the community - the ! Developers are free to make enhancements to the moderator tooling without having to work around 10K user restrictions. Questions Am I forgetting anything here? I haven't really spent much time in the 10K flag queue since back when it was filled with spam flags and therefore useful - is there a use-case that you depend on that would be lost with its removal? Post 'em below. *: on Stack Overflow, only .", "Where are the outliner toggles in 2.8?", "My client wants me to write a formula field to return the duration(in months and days) between two date fields. For ex: If start date is \"January 1st 2016\" and end date as \"December 31st 2016\" then it should return value as \"12\". If start date is \"January 1st 2016\" and end date as \"November 20th 2016\" then it should return value as \"11.67\". From the sample formulas given on the salesforce , I see that there is a formula date_1 — date_2 to calculate number of days between two dates. But should I update the formula to (date_1 — date_2)/30 or (date_1 — date_2)/31 to get what I need? Is this something really doable using formula or am I better off solving this using Apex?", "This started to happen immediately after I had rebooted the first time after doing a system upgrade. It first starts with a dialogue that says \"System program problem detected\". Then when I try to hit 'report problem' not much happens. I am led through a dialogue that always ends up the problem cannot be solved. I am aware this is not a lot of information, however I'm not sure which information I need to publish and how should I obtain it to debug this problem. Here's a screenshot!", "I'm reading that a 50mm lens is recommended as a first prime lens for DSLR owners as it's supposed to give a 'natural' perspective, but when used on (most) DSLRs, the view is cropped, as if you were zoomed in by 1.5-1.6x, so it's more of a telephoto lens when used on a DSLR. I've also read however that the 50mm lens gives the same perspective on a DSLR and a 35mm, and shouldn't really be considered to be 'equivalent' to an 80mm lens as the crop factor isn't really a magic focal length changer. Can someone explain how the image is different from (for example) a 50mm lens on a DSLR and an 80mm lens (assuming 1.6x crop factor) on a 35mm camera?", "A company is any form of business whether it is small or large. Generally the term &quot;company&quot; indicates a particular kind of business dealing in a specific product. An organisation is the larger form and generally comprises of a number of companies. Simply, a company is an organization, but an organization is not just a company. An industry is the combination of companies in same line of business. Firm, corporation and business are synonyms of &quot;company&quot;. An Agency is a particular kind of company, which serves as an intermediary between clients (other companies or individuals). Is this correct?", "bash: ./program: cannot execute binary file: Exec format error I'm trying to run a program, but an error happens like this: bash: ./program: cannot execute binary file: Exec format error The result of file program was: program: ELF-32-bit LSB executable, ARM, EABI4 version 1 (SYSV), dynamically linked(uses share libs), for GNU/LINUX 2.6.16, not stripped How can I fix this error? I'm using Ubuntu 14.04.2 (amd64) with VMware. I also tried with Ubuntu i386, but result was same.", "I bought a Minecraft account for my little brother for Christmas, and I'd like to play with him on my server every now and then. If I log in while he's on, however, it kicks him off since we have the same username. Is there any way to change my username so that I can play with him, or anything I can do so that we can both play together using this account on my server? I'm open to anything that could let us play, whether it be username changes, server property changes, etc.", "Programmatically selecting non adjacent Cells", "A question was asked in one of my friend's interview. The question was to determine the right form from the below sentences. Q. Correct form of English: Samuel was with Susan and I Samuel was with Susan and me Samuel was with I and Susan Samuel was with me and Susan None of these Now I vaguely remember a rule of thumb from my school days. That is \"2-3-1\" i.e. where all the persons are acting in a sentence, second person comes first, then third person and it is followed by first person. So according to this theory, 1 seems to be correct to me. Is this theory correct?", "When you call the object.__repr__() method in Python you get something like this back: &lt;__main__.Test object at 0x2aba1c0cf890&gt; Is there any way to get a hold of the memory address if you overload __repr__(), other then calling super(Class, obj).__repr__() and regexing it out?", "What is the \"last\" data that get's backed up, when running pg_dump on a live server? I'm wondering: If I start doing a pg_dump of a very large database (it would take hours), that is still running actively receiving writes, what is then the last data that goes into the backup? Is it: The data as-it-was, at the point in time where the pg_dump command was initiated. The last changes that it encountered at some point where it was dumping that individual record. Something else. Bonus question: If I'm trying to dump a database as part of trying to rescue it from corrupt data, will it then make any difference whether I use the directory format or the custom format?", "How to remove the Mail icon indicator applet?", "What is the origin of BrEng ‘bird’ meaning “young woman”? Bird: (Brit.) a girl or young woman, esp one's girlfriend () According to bird: \"maiden, young girl,\" c.1300, confused with (q.v.), but felt by later writers as a figurative use of (n.1). Modern slang meaning \"young woman\" is from 1915, and probably arose independently of the older word. also : , bird was used for ‘girl’, but this was probably owing to confusion with another similar middle English word, burde, which also meant ‘young woman’. The usage crops up from time to time in later centuries, clearly as an independent metaphorical application, but there does not really seem to be an unbroken chain of occurrences leading up to the sudden explosion in the use of bird for ‘young woman’ in the 20th century. (www.dictionarycentral.com) Modern usage of bird meaning girl appears to be unrelated to the old Middle Ages meaning. Etymonline dates it back precisely to 1915. What is the modern origin of bird meaning young woman? In what context did they start to use it at the beginning of the 20th century?", "Does the proof of Bolzano-Weierstrass theorem require axiom of choice? When selecting the terms of subsequence from each bisections, I thought axiom of choice might be required. But I'm not so sure whether or not, so please tell me. [edited] I'm sorry for the lack of explanation. I want to prove this statement: Let $a_1, a_2, \\ldots \\in \\mathbf{R}$, and $(a_n)_{n\\in\\mathbf{N}}$ is bounded, then $(a_n)$ has some convergent subsequence. The proof is as follows. Since $(a_n)$ is bounded, for all $n\\in\\mathbf{N}$, $a_n \\in I = [b, c]$. Now, let $I_0 = I$ and if $I_n = [b_n, c_n]$, we define $d_n = (b_n+c_n)/2$ and if infinite terms of $(a_n)$ is included in $[b_n, d_n]$(resp. $[d_n, c_n]$), we will define $I_{n+1} = [b_n, d_n]$(resp. $[d_n, c_n]$).If both intervals contain infinite terms, let $I_{n+1}$ be $[d_n, c_n]$. For all $n\\in \\mathbf{N}$, infinite numbers of $m \\in \\mathbf{N}$ exist such that $a_m \\in I_n$ suffices. We take the sequence of natural numbers $(n(k))_{k\\in\\mathbf{N}}$which suffices $n(0) &lt; n(1) &lt; \\cdots &lt; n(k) &lt; \\cdots$ following this procedure: Now we have already selected $a_{n(1)}, \\ldots, a_{n(k)}$, there are infinite numbers of $m\\in \\mathbf{N}$ which suffices $n(k)&lt;m, a_m \\in I_{k+1}$, so let's take the minimum m out of it. Applying this process recursively, we obtain a infinite convergent subsequence(?). I think intuitively, by only repeating this process we can't obtain countable infinite terms of subsequence because we have to repeat infinite times.", "How to verify iOS app integrity? If I write an app for iOS and it's accepted by the AppStore, how do I know if the app is actually the app I compiled and has not being substituted/altered by, say, a \"Man in the middle\" style interception/attack? Is there a way to do a checksum either after the fact or from inside the app itself?", "Why was River Song so slow?", "How do you remove Subversion control for a folder? I have a folder, c:\\websites\\test, and it contains folders and files that were checked out from a repository that no longer exists. How do I get Subversion to stop tracking that folder and any of the subfolders and files? I know I could simply delete the .svn folder, but there are a lot of sub-folders in many layers." ]

[ "How long would the conference be for? I want to know if this is grammatically correct \" How long would the conference be for?\".", "bash if -a vs -e option Both about -a and -e options in is said: -a file True if file exists. -e file True if file exists. Trying to get what the difference is I ran the following script: resin_dir=/Test/Resin_wheleph/Results if [ -e ${resin_dir} ] ; then echo \"-e \"; fi if [ ! -e ${resin_dir} ] ; then echo \"! -e\"; fi if [ -a ${resin_dir} ] ; then echo \"-a\"; fi if [ ! -a ${resin_dir} ] ; then echo \"! -a\"; fi /Test/Resin_wheleph/Results exists and is a directory. And this is what I get: -e -a ! -a which seems to be a little strange (notice -a and ! -a). But when I use double brackets (e. g. if [[ -e ${resin_dir} ]]) in the similar script it gives reasonable output: -e -a So: What is a difference between -a and -e options? Why -a produces a strange result when used inside single brackets?", "Unique constraint that allows empty values in MySQL", "I have a number of tiff files named: sw.001.tif sw.002.tif ... and I want to remove the .tif at the end of each of the files. How can I use the rename command to do this?", "How to make sure an application keeps running on Linux I'm trying to ensure a script remains running on a development server. It collates stats and provides a web service so it's supposed to persist, yet a few times a day, it dies off for unknown reasons. When we notice we just launch it again, but it's a pain in the rear and some users don't have permission (or the knowhow) to launch it up. The programmer in me wants to spend a few hours getting to the bottom of the problem but the busy person in me thinks there must be an easy way to detect if an app is not running, and launch it again. I know I could cron-script ps through grep: ps -A | grep appname But again, that's another hour of my life wasted on doing something that must already exist... Is there not a pre-made app that I can pass an executable (optionally with arguments) and that will keep a process running indefinitely? In case it makes any difference, it's Ubuntu.", "Is there a package of Ubuntu drivers as driver pack solution? I tried to search for it, but I did not find it. If there is, how can I easily get it?", ".NET Attributes: Why does GetCustomAttributes() make a new attribute instance every time? So I was playing around a little more with attributes in .NET, and realized that every call to Type.GetCustomAttributes() creates a new instance of my attribute. Why is that? I would think that the attribute instance would basically be a singleton-per-MemberInfo, with 1 instance bound to the Type, PropertyInfo, etc... Here is my test code: using System; namespace AttribTest { [AttributeUsage(AttributeTargets.Class)] class MyAttribAttribute : Attribute { public string Value { get; set; } public MyAttribAttribute() : base() { Console.WriteLine(\"Created MyAttrib instance\"); } } [MyAttrib(Value = \"SetOnClass\")] class MyClass { } class Program { static void Main(string[] args) { Console.WriteLine(\"Getting attributes for MyClass.\"); object[] a = typeof(MyClass).GetCustomAttributes(false); ((MyAttribAttribute)a[0]).Value = \"a1\"; Console.WriteLine(\"Getting attributes for MyClass.\"); a = typeof(MyClass).GetCustomAttributes(false); Console.WriteLine(((MyAttribAttribute)a[0]).Value); Console.ReadKey(); } } } Now if I were to implement attributes, I would expect the output to be: Created MyAttrib instance Getting attributes for MyClass. Getting attributes for MyClass. a1 Where the \"class loader\" (sorry, I have more of a Java background, not 100% sure how .net loads its types) would compile MyClass, and create an instance of MyAttribAttribute, and store them together somewhere. (probably the Perm Gen in the heap if this were Java) The 2 calls to GetCustomAttributes() would then just return the same earlier created instance. But the actual output is: Getting attributes for MyClass. Created MyAttrib instance Getting attributes for MyClass. Created MyAttrib instance SetOnClass So... why? It seems like creating a new instance of all these objects for every call is a bit excessive, and not good for performance/memory management. Is there any way to always get the same instance over and over? Anyone have any ideas why it was designed this way? The reason I care at all is because I made a custom attribute that internally holds some validation information, so in the Attribute I basically have a \"private bool Validated\" that I set to true. The validation stuff takes a while, so I don't want to run it every time. Now the problem is that since it creates a new instance of the attribute each time I get the attributes, Validated is always \"false\".", "Is it possible to switch from one area of graduate study to another in US universities? For example, suppose someone has enrolled in a computer science phd program. Can he switch over to math(or physics) phd program in the same school later?(or say from applied mathematics to pure mathematics?) What are the steps for doing for doing that?", "For sets $A,B$, let $|A|\\leq^*|B|$ say that there exists an onto map $f:B\\rightarrow A$ or $A=\\emptyset$. My question is, is $$\\forall A,B(|A|\\leq^*|B|\\longrightarrow |A|\\leq|B|)$$ equivalent to the axiom of choice? Thanks", "Let $f$ be a real, continuous function defined on $[0,\\infty)$ such that $xf(x)$ is increasing for all sufficiently large values of $x$. Show that if $$\\int_0^x f(y)\\,dy \\sim Ax^\\alpha \\quad \\left(\\,x\\to \\infty\\right)$$ for some positive constants $A$ and $\\alpha$, then $$f(x)\\sim \\alpha Ax^{\\alpha -1} \\quad \\left(\\,x\\to \\infty\\right).$$ Clearly, I have to use differentiation somewhere, but I don't know how to manipulate $\\lim_{x\\to \\infty}\\frac{\\int_0^x f(y)\\,dy}{Ax^\\alpha}=1$ to get the desired result. From suggestions given, I know that by L'hospital's rule, it's enough to show that the limit $\\lim \\frac{f(x)}{\\alpha Ax^{\\alpha -1}}$ exists, and this limit equals $ \\lim \\frac{xf(x)}{\\alpha Ax^{\\alpha}}$. From here, I'll need to use the given assumption that $xf(x)$ is eventually increasing. But how can I show the existence of the limit based on these facts? I would greatly appreciate any solutions, hints or suggestions.", "How do I calculate the date six months from the current date using the datetime Python module?", "XIV pages in page counts? Is it possible to make biblatex output page counts for both the regular pages and the roman-numbered pages, for example: Cook, Theodore Andrea. The Curves of Life : Being an Account of Spiral Formations and Their Application to Growth in Nature, to Science and to Art; with Special Reference to the Manuscripts of Leonardo da Vinci. — London : Constable and Company, 1914. — xxx + 479 p. Here there are \"30 pages + 478 pages\" in total. Thanks!", "Where is attribute table in ArcGIS Desktop when not visible? I've just updated to ArcGIS 10.1 for Desktop and when I go to open an attribute table, I can not see it anywhere. I'm wondering if it is off my screen somewhere or if its just super tiny that I can't see it. I'm using dual monitors and it's not popping up on either. Is there a way I can find my attribute table?", "I've been working with the Fermat numbers recently, but this problem has really tripped me up. If the Fermat theorem is set as $f_a=2^{2^a}+1$, then how can we say that for an integer $b&lt;a$, the $\\gcd(f_b,f_a)=1$?", "What's the best way of accessing field in the enclosing class from the nested class?", "Adding coordinate system to layout in QGIS composer?", "Can virtual particle have mass? Do all virtual particle travel at light speed in a vacuum? else wouldn't that imply they should have rest mass however tiny? When they pop back out of existence do their mass disappear instantly? BTW what is the heaviest virtual particle ever found?", "An integer $a \\pmod m$ has inverse if and only if $\\gcd(a,m)=1$? An integer $a \\pmod m$ has inverse if and only if $\\gcd(a,m)=1$? Why is this? I tried understanding it from my notes but I don't get it. A thorough explanation would be greatly welcome. Thanks for all the answers so far. I think my biggest problem is understanding why $\\gcd(a,m)\\neq1 \\Longrightarrow \\not\\exists a^{-1}$.", "Are there any XSLT processing command line tools?", "What are the best practices for modeling inheritance in databases? What are the trade-offs (e.g. queriability)? (I'm most interested in SQL Server and .NET, but I also want to understand how other platforms address this issue.)" ]

[ "Let $\\vec{k}$, $\\vec{v}$, and $\\vec{u}$ be vectors, where $\\vec{u}$ is unknown and $\\vec{k}$ and $\\vec{v}$ are known vectors. Given: $\\vec{u}\\cdot\\vec{k}=c$ $\\vec{u} \\times \\vec{k}= \\vec{v}$ From this relations, how can i determine the vector $u$? I tried to construct orthogonal coordinate system from $(\\vec{k}, \\vec{v},\\vec{k}\\times \\vec{v})$ but i couldn't proceed from there. Any idea?", "Use of the comment package", "How do you make samba follow symlink outside the shared path This is Ubuntu server 10.04 64 and samba 3.4.7. I have a shared directory /home/mit/share and another one /home/temp that I link into the shared one: ln -s /home/temp /home/mit/share/temp But on windows, after using internet, I cannot open S:/temp, but on Linux it is possible to access /home/mit/share/temp like expected. This works if I link directories inside /home/mit/share/temp, so I guess samba is restricting to jump with a link outside/above the shared directory. EDIT: See also this question titled . It seems best to put unix extensions = no into the global section and follow symlinks = yes and wide links = yes only into the shares section, where you really need it. The unix extension flag has to live in the global section and not in the individual shares sections. But for security reasons it is better to use the other options only where you need it, and not globally.", "Removing columns in a SpatialPolygonsDataFrame in R? My spatial polygon data frame (SPDF) contains too many columns (variables) and I want to remove most of the columns entirely. I know how to do this with a regular data frame in R, but I am unsure how to do this when dealing with object of class SpatialPolygonsDataFrame?", "I'm totally new to Ubuntu/Linux, using Ubuntu Server at the moment. Just trying to figure out something basic. How can you tell where you are installing a program. For example I just installed Sphinx search engine by placing the tarball that I downloaded from their site to my: /home/sphinx directory. I created the sphinx directory to place that tarball in. Then I ran these commands: tar xvzf sphinx-0.9.8.1.tar.gz cd sphinx-0.9.8.1/ ./configure --with-mysql-includes=/usr/include/mysql --with-mysql-libs=/usr/lib/mysql and then these: make sudo make install Now I have a lot of files sitting in the directory where I ran these commands. Is this my Spynx installation or did it install somewhere else? In windows if you run an installer (.exe file) anywhere the program will still install in your C:\\Program Files directory. Does something similar apply to linux where all programs are installed in a central place, or can you install programs anywhere on the system. Questions I would prefer to keep all my installed programs in one place so what is the right place for this in terms of best practice. In other words what is the Linux equivalent of C:\\Program Files? And how does one always install at this location, is it just a matter of placing the tarball and running the install commands from this location? What about if I use sudo apt-get to install a package. How can I point to this location to tell apt-get to always install there?", "Launch app only if not already open", "Binary search (bisection) in Python", "Motivation: I once had one surplus card on my hand, and knew the robbers would come soon. So I gave it to someone for free, to avoid losing more cards when they hit. I was surprised by how badly this was received. Two of the three other players (the hosts of the game) acted upset, like I had tried to cheat. I had to take the card back, get robbed the next turn and 'giving cards away for free' was banned immediately. (Oh, how I hate mid-game additions to the rules. But that's beside the point.) So now the question: Is this really illegal in Settlers of Catan? Is it generally considered underhanded in any way? If so, why? My reasoning was like this: Consider players A and B. A wants to give B a sheep. A trades a sheep and one rock to B, in exchange for wheat. A trades the received wheat for the (formerly his) rock. A and B now both have the same resources they had in the beginning, only the sheep has moved from A to B.", "Sequence of differentiable functions Let $f_n$ be a sequence of differentaible functions on $[0,1]$ to $\\mathbb{R}$ converging uniformly to a function $f$ on $[0,1]$, Then $f$ is differentiable and Riemann integrable there $f$ is uniformly continuous and R-integrable $f$ is continuous, need not be differentiable on $(0,1)$ and need not be R-integrable on $ [0,1]$, $f$ need not be continuous. Well I think 2 is only correct statement as every $f_n$ are differentiable on $[0,1]$ hence uniformly contnous, and as they converge uniformly to $f$ on $[0,1]$ so $f$ is uniformly continuous and every continuous function is rieman integrable..Am I correct?", "This seems to be a chicken-egg problem. The most common task using sudo is installing and removing software. sudo apt-get purge &lt;appname&gt; But sudo itself can be removed. sudo apt-get purge sudo # Do not run this command on production computers! This is where the fun comes ubuntu@ubuntu:~$ sudo bash: /usr/bin/sudo: No such file or directory Although it's obvious that no person in his right mind will purge sudo (other than me), someone can be fooled to run this command (not directly, in its hex mode, or whatever it's called) or a person could SSH in disguised as tech guru and do the mess. So is there a way of reinstalling sudo?", "One asks “how does x taste,” implying that they’d like an adverb describing the way it tastes. But one answers with an adjective, “it tastes good” instead of “it tastes well,” which would imply that x is tasting something else. What’s the reason for this discrepancy?", "How to Give Credit for An Answer in the Comments I asked a question on SO and someone gave me the answer as a comment to the question. Subsequently, someone else gave the same answer as an answer. I would like to give credit to the poster who made the comment. Is there any way to do that? Being new to the site, my only thought would be to contact the commenter and tell him to post an answer if he/she wants credit.", "Shortest code to calculate list min/max in .NET I'd like something like int minIndex = list.FindMin(delegate (MyClass a, MyClass b) {returns a.CompareTo(b);}); Is there a builtin way to do this in .NET?", "Add a rule after chapter title using titlesec", "What does a Terminator do after its mission is accomplished? A Terminator is essentially given a mission or an objective (\"Go back in time and kill Sarah Connor\" or something of the like). What does a Terminator do once its mission is accomplished? We see in Terminator 2: Judgment Day (the live-action movie) that the (played by Arnold Terminator Schwarzenegger) completed its mission of protecting the Connors, and then sort-of just melted itself into nothingness (presumably to protect the world from discovering Terminators again). But what would the or the (in Terminator 3) have done? Are they given multiple directives (\"Go kill Sarah Connor, then go kill Robert Baratheon, and then have a nice hot bath; you've earned it\")? This question is related, but not a dupe:", "Proof by Induction: Prove that $2^n > n^2$, for all natural numbers greater than or equal to $5$", "Prove that the interval $(0, 1)$ and the Cartesian product $(0, 1) \\times (0, 1)$ have the same cardinality Prove that the interval $(0, 1)$ and the Cartesian product $(0, 1) \\times (0, 1)$ have the same cardinality using the SB theorem? Also how does one find a bijection on $f:(0, \\infty) \\to (0,1)$ such that they have the same cardiniality?", "Do we have any experimental evidence to confirm that light is an electromagnetic wave? Or is it confirmed simply by Maxwell's equations showing a similarity in speed?", "“have found” vs. “found”", "What should I do when my neural network doesn't learn? I'm training a neural network but the training loss doesn't decrease. How can I fix this? I'm not asking about overfitting or regularization. I'm asking about how to solve the problem where my network's performance doesn't improve on the training set. This question is intentionally general so that other questions about how to train a neural network can be closed as a duplicate of this one, with the attitude that \"if you give a man a fish you feed him for a day, but if you teach a man to fish, you can feed him for the rest of his life.\" See this Meta thread for a discussion: If your neural network does not generalize well, see:" ]

[ "I have a Linux instance that I set up some time ago. When I fire it up and log in as root there are some environment variables that I set up but I can't remember or find where they came from. I've checked ~/.bash_profile, /etc/.bash_rc, and all the startup scripts. I've run find and grep to no avail. I feel like I must be forgetting to look in some place obvious. Is there a trick for figuring this out?", "How to register domain for 15 years? I have heard that Google trust that website which has long expiry date. that want to know how can I register my domain for a long period.", "swap x and y axis on data generated plot", "Determining if a game is CPU- or GPU-limited What is a reliable, but not too time-consuming way to determine if a certain game is limited by the graphics card or by the processor speed? I have some preconceptions about whether I'm mostly GPU or CPU limited, but I'd like to verify if I'm right about that. I have some ideas how I would go around and test that but performing accurate benchmarks is notoriously tricky and I don't have much experience with it. So I'm wondering what would be an easy way to determine the bottleneck, having only one computer with a certain configuration available? What tools would I use for that purpose? It would also be interesting to determine if the amount of VRAM on my graphics card is a limiting factor.", "How to get object size in memory? I need to know how much bytes my object consumes in memory (in C#). for example how much my Hashtable, or SortedList, or List&lt;String&gt;.", "Can a child enter the UK on an accompanied visa and then leave the country alone? My daughter who is just under 18 has a child accompanied visa to the UK. I am traveling with her to the UK for a few days. We return from UK on the same day except that she returns to India and I am heading to San Francisco an hour later on the same day. Is that okay or will we have an issue at immigration into the United Kingdom?", "Python: List vs Dict for look up table I have about 10million values that I need to put in some type of look up table, so I was wondering which would be more efficient a list or dict? I know you can do something like this for both: if something in dict_of_stuff: pass and if something in list_of_stuff: pass My thought is the dict will be faster and more efficient. Thanks for your help. EDIT 1 Little more info on what I'm trying to do. . I'm making a look up table to see if a value calculated has all ready been calculated. EDIT 2 Efficiency for look up. EDIT 3 There are no values assosiated with the value...so would a set be better?", "Good 1st PDE book for self study What is a good PDE book suitable for self study? I'm looking for a book that doesn't require much prerequisite knowledge beyond undergraduate-level analysis. My goal is to understand basic solutions techniques as well as some basic theory.", "Execute a program at login I'm running Arch-Linux ARM on a Raspberry Pi. My project goal is to have a barcode scanner attached to the Pi that forwards the scanned messages to a server in a LAN. To harden the system against power outages etc. and minimize required user interaction, I wish to set it up so that a certain user is logged in automatically at startup (done and works) and a specific program is to be run at startup (done and works but not as intended). I've done this so far by adding exec mono scannerSoftware.exe 127.0.0.1 1234 randomString to /home/certainUser/.bash_profile so it gets executed only once even when I'm switching back and forth to root (in contrast to bashrc). The particular problem I am having: When I launch the system, it works as intended (login as certainUser, starting scannerSoftware.exe); BUT if I want to switch users and hit Ctrl+C, it restarts the login process, logging certainUser in again and running the program again => back to where I came from. My guess as to why this happens is that the sys detects \"login not complete, better start it again\". I could circumvent this by spamming Ctrl+C right around the login so that I practically interrupted it. Of course, this is not good practice. Suffice it to say it is not practical at all. My question: How can I set it up so the program gets executed AFTER login is complete so that Ctrl+C'ing out brings me to a normal bash prompt as certainUser instead of beginning the endless login-cycle? EDIT: I'm not using any graphical interface or such, only commandline (bash on tty), because when done the system won't even have a display.", "Which computer science / programming Stack Exchange sites do I post on?", "Choosing between $z$-test and $t$-test Background: I'm giving a presentation to colleagues at work on hypothesis testing, and understand most of it fine but there's one aspect that I'm tying myself up in knots trying to understand as well as explain it to others. This is what I think I know (please correct if wrong!) Statistics that would be normal if variance was known, follow a $t$-distribution if the variance is unknown CLT (Central Limit Theorem): The sampling distribution of the sample mean is approximately normal for sufficiently large $n$ (could be $30$, could be up to $300$ for highly skewed distributions) The $t$-distribution can be considered Normal for degrees of freedom $&gt; 30$ You use the $z$-test if: Population normal and variance known (for any sample size) Population normal, variance unknown and $n&gt;30$ (due to CLT) Population binomial, $np&gt;10$, $nq&gt;10$ You use the $t$-test if: Population normal, variance unknown and $n&lt;30$ No knowledge about population or variance and $n&lt;30$, but sample data looks normal / passes tests etc so population can be assumed normal So I'm left with: For samples $&gt;30$ and $&lt;\\approx 300$(?), no knowledge about population and variance known / unknown. So my questions are: At what sample size can you assume (where no knowledge about population distribution or variance) that the sampling distribution of the mean is normal (i.e. CLT has kicked in) when the sampling distribution looks non-normal? I know that some distributions need $n&gt;300$, but some resources seem to say use the $z$-test whenever $n&gt;30$... For the cases I'm unsure about, I presume I look at the data for normality. Now, if the sample data does looks normal do I use the $z$-test (since assume population normal, and since $n&gt;30$)? What about where the sample data for cases I'm uncertain about don't look normal? Are there any circumstances where you'd still use a $t$-test or $z$-test or do you always look to transform / use non-parametric tests? I know that, due to CLT, at some value of $n$ the sampling distribution of the mean will approximate to normal but the sample data won't tell me what that value of $n$ is; the sample data could be non-normal whilst the sample mean follows a normal / $t$. Are there cases where you'd be transforming / using a non-parametric test when in fact the sampling distribution of the mean was normal / $t$ but you couldn't tell?", "My /boot partition is nearly full and I get a warning every time I reboot my system. I already deleted old kernel packages (linux-headers...), actually I did that to install a newer kernel version that came with the automatic updates. After installing that new version, the partition is nearly full again. So what else can I delete? Are there some other files associated to the old kernel images? Here is a list of files that are on my /boot partition: :~$ ls /boot/ abi-2.6.31-21-generic lost+found abi-2.6.32-25-generic memtest86+.bin abi-2.6.38-10-generic memtest86+_multiboot.bin abi-2.6.38-11-generic System.map-2.6.31-21-generic abi-2.6.38-12-generic System.map-2.6.32-25-generic abi-2.6.38-8-generic System.map-2.6.38-10-generic abi-3.0.0-12-generic System.map-2.6.38-11-generic abi-3.0.0-13-generic System.map-2.6.38-12-generic abi-3.0.0-14-generic System.map-2.6.38-8-generic boot System.map-3.0.0-12-generic config-2.6.31-21-generic System.map-3.0.0-13-generic config-2.6.32-25-generic System.map-3.0.0-14-generic config-2.6.38-10-generic vmcoreinfo-2.6.31-21-generic config-2.6.38-11-generic vmcoreinfo-2.6.32-25-generic config-2.6.38-12-generic vmcoreinfo-2.6.38-10-generic config-2.6.38-8-generic vmcoreinfo-2.6.38-11-generic config-3.0.0-12-generic vmcoreinfo-2.6.38-12-generic config-3.0.0-13-generic vmcoreinfo-2.6.38-8-generic config-3.0.0-14-generic vmcoreinfo-3.0.0-12-generic extlinux vmcoreinfo-3.0.0-13-generic grub vmcoreinfo-3.0.0-14-generic initrd.img-2.6.31-21-generic vmlinuz-2.6.31-21-generic initrd.img-2.6.32-25-generic vmlinuz-2.6.32-25-generic initrd.img-2.6.38-10-generic vmlinuz-2.6.38-10-generic initrd.img-2.6.38-11-generic vmlinuz-2.6.38-11-generic initrd.img-2.6.38-12-generic vmlinuz-2.6.38-12-generic initrd.img-2.6.38-8-generic vmlinuz-2.6.38-8-generic initrd.img-3.0.0-12-generic vmlinuz-3.0.0-12-generic initrd.img-3.0.0-13-generic vmlinuz-3.0.0-13-generic initrd.img-3.0.0-14-generic vmlinuz-3.0.0-14-generic Currently, I'm using the 3.0.0-14-generic kernel.", "Short story identification: society partitioned off by high wall Reading another question today reminded me of a short story I read in the early 90s (probably written in 60s or 70s though). A society is blocked off by a really high wall; the story follows a girl who tries to get over the wall. I think she manages it with a hot air balloon. When she reaches the other side she meets an older man who had managed to scale the wall in his youth - his solution had been to use a flock of birds to carry him. UPDATE I seem to recall that it splits off an elite group of people - getting over the wall is like a rite of passage. Most people don't even bother to get over it (or even be concerned by its existence at all), but a few try. There might be some magic involved (on the other / better side), or they might just be more advanced technologically. FINAL UPDATE As pointed out in the answer, and confirmed by me re-reading the story, I was mistaken in a few details. The main protagonist is not a girl, it's a boy called Porgie. He doesn't use a balloon, it's a glider he made, assisted with a broom. Magic is involved, but it's on the inside, with technology on the outside.", "I'm using a class I've derived from DocumentPaginator (see below) to print simple (text only) reports from a WPF application. I've got it so that everything prints correctly, But how do I get it to do a print preview before printing? I have a feeling I need to use a DocumentViewer but I can't figure out how. Here's my Paginator Class: public class RowPaginator : DocumentPaginator { private int rows; private Size pageSize; private int rowsPerPage; public RowPaginator(int rows) { this.rows = rows; } public override DocumentPage GetPage(int pageNumber) { int currentRow = rowsPerPage * pageNumber; int rowsToPrint = Math.Min(rowsPerPage, rows - (rowsPerPage * pageNumber - 1)); var page = new PageElementRenderer(pageNumber + 1, PageCount, currentRow, rowsToPrint) { Width = PageSize.Width, Height = PageSize.Height }; page.Measure(PageSize); page.Arrange(new Rect(new Point(0, 0), PageSize)); return new DocumentPage(page); } public override bool IsPageCountValid { get { return true; } } public override int PageCount { get { return (int)Math.Ceiling(this.rows / (double)this.rowsPerPage); } } public override Size PageSize { get { return this.pageSize; } set { this.pageSize = value; this.rowsPerPage = PageElementRenderer.RowsPerPage(this.pageSize.Height); if (rowsPerPage &lt;= 0) throw new InvalidOperationException(\"Page can't fit any rows!\"); } } public override IDocumentPaginatorSource Source { get { return null; } } } The PageElementRenderer is just a simple UserControl that displays the data (at the moment just a list of rows). Here's how I use my Row Paginator PrintDialog dialog = new PrintDialog(); if (dialog.ShowDialog() == true) { var paginator = new RowPaginator(rowsToPrint) { PageSize = new Size(dialog.PrintableAreaWidth, dialog.PrintableAreaHeight) }; dialog.PrintDocument(paginator, \"Rows Document\"); } Sorry for the code dump, but I didn't want to miss something relevant.", "Reading from text file until EOF repeats last line", "Class of sets of a given infinite cardinality This question was inspired by the question on . From the discussion in the comments there, it seems there does not exist a set of all sets of a given cardinality. To me, it seems easy to see that this is true for any nonzero finite cardinality $n$. Given any set $x$, you can always make a set of size $n$ by adding $n-1$ other sets to $x$ to make a set of size $n$, which exists by repeated use of the pairing axiom. But how would you do this for infinite cardinalities? For suppose $\\kappa$ is some given infinite cardinality. To show that the set of all sets of cardinality $\\kappa$ does not exist, it seems you would have to show that for any set $x$, there exists a set of that size with $x$ as an element, and then you could take the union of that set to find the set of all sets, and thus a contradiction. But it doesn't seem reasonable to simply say, for a given set of size $\\kappa$ if $x$ is in the set, we have no problem. If not, just take an element out of the set and put $x$ in. Something about that seems like it would not be allowed. So how would you do this for infinite cardinalities?", "I get it after updating in Synaptic Manager I recently did a clean install of Ubuntu 17.04 from 16.10. error message:- W: Download is performed unsandboxed as root as file '/var/cache/apt/archives/partial/samba-libs_2%3a4.5.8+dfsg-0ubuntu0.17.04.1_i386.deb' couldn't be accessed by user '_apt'. - pkgAcquire::Run (13: Permission denied)", "how to display the actual network traffic (wireless) in a terminal? Additionally: Is it possible to add this info to the chart of top?", "Is there an AmpScript function that can be used in an equivalent manner to sql left, right and mid functions? Thanks, Mark", "How to compute $\\lim\\limits_{n\\rightarrow \\infty} \\{(2+\\sqrt{3})^{n}\\}$, where $\\{x\\}$ is the fractional part of $x$? I've stumbled upon the following problem: $$\\lim_{n\\rightarrow \\infty} \\{(2+\\sqrt{3})^{n}\\}$$ where \"{}\" notates the fractional part. I've never studied this kind of problem, there exists any reference that I could read about this type of problem?" ]

[ "First time I've used cycles rendering engine. I'm using a movie clip as the background in short animation. Selected RBGA under Property Tab, and Transparent under Film Tab. It looks good and individual frames in OpenGL active viewport render, and looks fine. When I try to get it to spit out PNG files of the finished animation the objects render out fine, except no movie clip background as Blender Render engine did when using Paper Sky setting. Operator error, or am I trying to do something Cycles won't do? Haven't found an answer in my searches so far. Can anyone point me in the right direction please. Addition: I think I found my problem after a couple more hours of research. Post should read \"operator ignorance\" instead of operator error. Too tired to try the solution tonight, everything looks better in the morning. Thanks anyway. Sorry, I just saw your posts. Really tired. Much appreciation.", "I am quite new to DSLRs and one of the first things I noticed was the incredible focus points and appearance of depth that you can achieve. That is great in a lot of scenarios, but not in all. When filming a landscape as a whole, I do not want to have the focus on that single tree, but on the whole skyline. Is there a way by which you can sort-of \"disable\" the focus, so that the raw image is recorded without any added blur? I suppose something as simple as this is only a small function you can turn off, but I can't seem to find it in the manual of my camera.", "Updating to latest Blender version I currently have version 2.74. How do I update to version 2.76? I do not see any links in the UI to update my version of Blender", "How do you determine using stat() whether a file is a symbolic link?", "How to add tags to files in Windows 7 so that they appear in search results In Windows 7, I want to add tags to my files (PDF, Word, Images etc) so that they appear directly in the search results, regardless of their content, title etc. shows how to search by tag, but it does not tell how to add a tag in any file. In the long term, I'm planning to add such tags programmatically as well.", "Is indefinite integration non-linear?", "The \"correct\" way to write a set without a specific element is as follows: $S \\setminus \\{s\\}$ But in some contexts this is cumbersome to write/type or read, and it detracts from the flow of the writing. Is it acceptable to just use $S \\setminus s$? Edit: By \"cumbersome\" i mean they look bad when you're trying to inline formulas in LaTeX.", "Do not give the impression that all votes are unanimously in favor of the winning close-reason. I closed for \"belongs on superuser,\" yet SO claims I closed for a completely different reason. Source:", "Inheriting constructors Why does this code: class A { public: explicit A(int x) {} }; class B: public A { }; int main(void) { B *b = new B(5); delete b; } Result in these errors: main.cpp: In function ‘int main()’: main.cpp:13: error: no matching function for call to ‘B::B(int)’ main.cpp:8: note: candidates are: B::B() main.cpp:8: note: B::B(const B&) Shouldn't B inherit A's constructor? (this is using gcc)", "Can we show new/anonymous users more Q&A? With left nav, responsive design, and various new-user notices, this is what an anonymous user currently sees (browser window here is 1090px wide): I realize that a lot of this content -- code of conduct, new-user intro, cookies notice -- is important. And I get that the left nav is an important design element, and responsive design dictates the width of the right column. But when you add it all up, Q&amp;A -- what the site is about -- gets a distressingly small portion of the screen. Can we do better? Maybe we can make that intro/mini-tour shorter? Maybe we can hide the right column for anonymous users? Maybe some things can wait until the user's viewed a few pages? Maybe other things I haven't thought of? My concern is that anonymous users -- people coming from Google, people who were referred to a site by users hoping to recruit them, or others who find their way to us but aren't invested in us -- will turn away before seeing how rich and helpful our sites are. Which would be a real shame, because our sites are awesome. First impressions matter. When I'm asking a rabbi to check out Mi Yodeya or a professional chef to check out Seasoned Advice or my vet to check out Pets (all of these have happened), I want to make a good impression. I want the person to see more than 2.5 questions; I want to increase the chances the person will see something interesting or say \"oh I can answer that!\" and dig deeper. Yes, the other stuff is important, but maybe not now? Is there a better way to \"stage\" all this information for people we haven't yet hooked?", "White screen of death: Fatal error: Allowed memory size of X bytes exhausted I have a issue with my Drupal installation, for example: when I enable or disable the modules, It redirects me to a blank page, when I create a new content type and save it, redirects me to a blank page, when I add a new view and save it, it redirects me to a blank page, when I try to clear the cache, it redirects me back to a blank page, or in similar cases. Basically all the confirmation pages redirect me to a white screen. When I refresh it again, it shows me the page. I tried to increase the PHP memory value but it doesn't help. Are there any other solutions for this? The error which I'm having: Fatal error: Allowed memory size of 100663296 bytes exhausted (tried to allocate 8192 bytes) in sites/all/modules/views/plugins/views_plugin_localization_none.inc on line 1", "Set Theory: Tree Property Why does the tree property hold for regular cardinals but not singular cardinals? (I.e. There exists a tree of height $\\kappa$ with countable levels and no cofinal branch for $\\kappa$ a singular cardinal)", "fontawesome icons are getting too big using XeLaTeX The following example must be compiled with XeLaTeX to reproduce the issue. % arara: xelatex \\documentclass{article} \\usepackage{fontawesome} \\begin{document} Text Text \\faMobilePhone\\ Text Text \\end{document} Normally I am using TeXworks to compile and view the output. With the internal viewer I am getting the desired result. The following image demonstrates it: However if I open the pdf with Preview (viewer of Mac) the scaling of the icon fails. If I open the pdf file with Adobe Acrobat Reader the icon is still scaled correctly. If I print the page my printer is also not able to scale the icons correctly. If I use LuaLaTeX everything seems to work correctly. Can you reproduce the issue and do you know a solution?", "I want to click on file to inherit the name for the file being saved. I can't read file names in the dialog box because the color is too faint. This is the same question as That question does not have an answer but I don't have enough points to interact there so I have to post a new question. Edited to add screen shots I tried to calibrate the monitor which no effect and did not change the readability of \"unavailable\" file names. I have added screenshots of previous operating systems to compare: Please tell me how Mojave is not to blame here:", "How can I remove the site URL from enqueued scripts and styles? I'm dealing with an SSL issue and I would like to strip the domain from all scripts and styles being output via wp_enqueue_scripts. This would result in all scripts and styles being displayed with a relative path from the domain root. I imagine there is a hook that I can use to fileter this, however, I am not sure which one, nor how to go about it.", "the verb in plural with one company", "I have an internal microphone in my laptop. I think it uses Intel High Definition Audio. But I can't get it to work with Ubuntu. It doesn't work with either the Sound Recorder or Skype. On the Input tab in 'Sound Preferences', I just see Internal Analog Input Device...", "I am using a mirror modifier for modelling. When viewing the mesh in edit mode, the vertices in the center are firmly stuck together and cannot be separated. When in pose mode, I manipulate a wrist bone on my model and the mesh splits in two along the mirror axis center. I have tried removing the subsurface modifier to see if this was the problem leaving only the armature at the top of the modifier list,i.e. as first modifier (which I am told is the bottom of the stack) and the mirror as the second. It doesn't separate in edit mode and I've also tried increasing the merge limit to 0.1 and there's no change. Manipulating bones separates the mesh.", "How do i create a linestring from points sort by date in PostgreSQL? I tried: SELECT observations.id, ST_MakeLine(observations.geom ORDER BY observations.date) AS newgeom FROM observations GROUP BY observations.id; This is going wrong. It returns me a linestring with same coordinates. So, instead of a line from a to b, it gives me a to a. What am I doing wrong?", "Management of fruit bowls on the Enterprise D I have noticed that guest quarters on the Enterprise D have fruit bowls on their tables. A prominent instance is the fruit bowl in Berlinghoff Rasmussen's quarters in \"\". The first thing that Rasmussen does when Data takes him to his guest quarters is take a piece of fruit and shove it in his pocket. Who replicates fruit for these fruit bowls before guests arrive? More generally, who removes unused fruit and tidies quarters after guests leave? Is there a ship hospitality staff, perhaps including Guinan's wait staff in Ten Forward?" ]

[ "I am travelling form Delhi (DEL) to San Francisco (SFO), I have to make a connection flight in Vienna that would take me to Frankfurt (FRA). My flight to SFO is from FRA, I have one ticket for entire journey and the flights are operated by Lufthansa or its subsidiaries. Do I need a transit visa? My flight arrives at Vienna international airport and leaves from the same, and for second leg it arrives at Frankfurt international airport. I asked this question as an addendum to my but was advised to make a new post. I hold Indian passport and valid US visa.", "What is the command to open the shutdown dialog?", "How to Detect workstation/System Screen Lock/unlock in windows OS using java?", "Proving a function is Lipschitz continuous Show that the following function is Lipschitz continuous and find a Lipschitz constant $$y\\mapsto f(x,y)\\\\ f(x,y)=\\frac{y}{x}\\ln(\\frac{y}{x})\\text{ , } |x-1|\\leq\\frac{1}{2}\\text{ , } |y-e|\\leq\\frac{e}{2} $$ I have no clue on where to begin to prove this. My first question is how I should interpret this function, is $x$ a sort of constant?", "In Data Extension one field 'HTML' have Data that I have shown below, Now I have to Find the 'Href', and and at the last of URL append some text like '&amp;MC='. It may have Multiple 'Href'. Please help me on this. &lt;table width=\"540\" style=\"margin: 0px; padding: 0px;\" bgcolor=\"#ffffff\" border=\"0\" cellspacing=\"0\" cellpadding=\"0\"&gt; &lt;tbody&gt; &lt;tr&gt; &lt;td valign=\"top\"&gt; &lt;h5 style=\"margin: 0px; padding: 0px 0px 2px; line-height: normal; font-family: &amp;quot;Segoe UI&amp;quot;, &amp;quot;Lucida Grande&amp;quot;, Verdana, Arial, Helvetica, sans-serif; font-size: 16px; font-weight: normal;\"&gt; &lt;a style=\"text-decoration: none;\" href=\"https://test.4.com/testRegistration/testLobbyServlet?target=reg20.jsp&amp;eventid=897605&amp;sessionid=1&amp;key=2F3D1EB963D9DB7738BF2877DFFDBA01&amp;partnerref=Social&amp;sourcepage=register&amp;loc=zOTlocz&amp;prod=zWAz&amp;tech=zsecz&amp;prog=zOTprogz&amp;type=zOTtypez&amp;media=zWCz&amp;country=zUSz\" alias=\"Success with Enterprise Mobility: Making email and Office 365 secure on mobile devices\"&gt; Success with Enterprise Mobility: Making email and Office 365 secure on mobile devices &lt;/a&gt; &lt;/h5&gt; &lt;p style=\"margin: 0px; padding: 0px; line-height: 20px; font-family: &amp;quot;Segoe UI&amp;quot;, &amp;quot;Lucida Grande&amp;quot;, Verdana, Arial, Helvetica, sans-serif; font-size: 12px; font-weight: normal;\"&gt; &lt;span style=\"color: rgb(103, 103, 103);\"&gt; &lt;em&gt;December 9, 2014, 10:30 A.M.&amp;ndash;11:30 A.M. Pacific Time&lt;/em&gt;&lt;br&gt; An enterprise mobility strategy involves identity, management, and productivity. In this session featuring Brad Anderson, you will learn about the integration and the Office mobile apps while enabling secure mobile productivity. &lt;/span&gt; &lt;/p&gt; &lt;/td&gt; &lt;/tr&gt; &lt;tr&gt; &lt;td valign=\"top\"&gt;&amp;nbsp; &lt;/td&gt; &lt;/tr&gt; &lt;tr&gt; &lt;td valign=\"top\"&gt; &lt;h5 style=\"margin: 0px; padding: 0px 0px 2px; line-height: normal; font-family: &amp;quot;Segoe UI&amp;quot;, &amp;quot;Lucida Grande&amp;quot;, Verdana, Arial, Helvetica, sans-serif; font-size: 16px; font-weight: normal;\"&gt; &lt;a style=\"text-decoration: none;\" href=\"http://test.TTr.com/?Wt.mc_id=IG15W2NWTN&amp;loc=zOTlocz&amp;prod=zWAz&amp;prod=zWSz&amp;tech=zCLz&amp;prog=zOTprogz&amp;type=zEVz&amp;media=zOTmediaz&amp;country=zUSz\" alias=\"Test: Everything about enterprise technology under one roof\"&gt; Test: Everything about enterprise technology under one roof &lt;/a&gt; &lt;/h5&gt; &lt;p style=\"margin: 0px; padding: 0px; line-height: 20px; font-family: &amp;quot;Segoe UI&amp;quot;, &amp;quot;Lucida Grande&amp;quot;, Verdana, Arial, Helvetica, sans-serif; font-size: 12px; font-weight: normal;\"&gt; &lt;span style=\"color: rgb(103, 103, 103);\"&gt; &lt;em&gt;May 4&amp;ndash;8, 2015, Chicago, IL&lt;/em&gt;&lt;br&gt; If you&amp;rsquo;re serious about technology, you don&amp;rsquo;t want to miss Test. This event will be the intersection of everything in enterprise technology. Get ahead in your job and your career. &lt;/span&gt; &lt;/p&gt; &lt;/td&gt; &lt;/tr&gt; &lt;/tbody&gt; &lt;/table&gt;", "How to derive this binomial identity?", "On the one hand, I'm aware that in the US do not have a valid government ID. On the other hand, traveling within the US requires you to show a piece of ID wherever you go - even when taking a Greyhound. So let's say you're an American who has a large number of cash in their pocket but no ID whatsoever. Would you be able to get from New York to San Francisco or from Seattle to Miami? If so, what are your options? Even though I do have plenty of identification documents, I find it enjoyable to be able to travel anonymously.", "What is a word that means \"someone who pretends to be your friend but is actually your enemy?\"", "Wrong Java resource bundle loaded", "I am getting really confused now. I installed Tex Live 2012 on my Xubuntu 12.04 with a backport and I installed TexMaker. I could user PdfLatex right away and it generated everything I needed except my bibliography. I read that Tex Live 2012 comes with biblatex so I just changed the bibtex command in TexMaker from \"bibtex\" to \"biblatex\". However, that does not exist. So I did sudo apt-get remove biblatex sudo apt-get install biblatex The package is installed but I don't find the binary. Using bibtex the whole thing crashes. Which does not surprise me since I want to userbiber: \\usepackage[backend=biber]{biblatex} Btw does biber come with biblatex? So far I couldn't get any clear explanation what biber and biblatex are to each other. EDIT: I had to remove texlive completely and install it with the install script form . Apparently the newest version of biber does not work with the older version of biblatex I had.", "Is there an official list of Disney Princesses?", "So I was in my New Leaf house and I accidentally put on a pair of pants instead of displaying them. Then I went and clicked on myself and I have no option to take off my pants. Ever. I swapped them with another pair for the display, but I can't get those off either. And the weird bit is when I put on the pants nothing was swapped back to my inventory. How do I take off my pants?", "Publishing a review in a peer-reviewed Wiki vs a traditional journal? The topic of Wikipedia contribution has come up before, but I am interested in the community's opinion on peer-reviewed wiki publishing (e.g., Scholarpedia). I would like to know if there is any advantage for a PhD student to publish in such an online venue versus the traditional journal publication for review content. The advantages I see to the wiki approach is free of charge publication, open access for all, not necessarily being limited by character limits. However, the disadvantages I see could be the citation being completely ignored by the intended audience and therefore missing out on the benefits of scientific communication and the possible loss of accompanying reputation for the publication. I would also worry these publications would be ignored or minimized by future supervisors and review committees.", "Why am I getting a NoClassDefFoundError in Java? I am getting a NoClassDefFoundError when I run my Java application. What is typically the cause of this?", "Basic question about Merging faces I'm a beginner with blender so this is probably a very basic question. I have this basic model below. I've ended up with a lot of unwanted geometry that I want to simplify. I wanted to start by merging the two selected faces below but no matter what I try to delete or merge it just destroys the geometry. How can I achieve what I want to do (which is combining all of the unwanted geometry, either starting with this merge or some other way?)", "How are large amounts of money expected to be made during the early parts of the Waterdeep: Dragon Heist adventure?", "Prove $(a^2+b^2)(c^2+d^2)\\ge (ac+bd)^2$ for all $a,b,c,d\\in\\mathbb{R}$. Prove $(a^2+b^2)(c^2+d^2)\\ge (ac+bd)^2$ for all $a,b,c,d\\in\\mathbb{R}$. So $(a^2+b^2)(c^2+d^2) = a^2c^2+a^2d^2+b^2c^2+b^2d^2$ and $(ac+bd)^2 = a^2c^2+2acbd+b^2d^2$ So the problem is reduced to proving that $a^2d^2+b^2c^2\\ge2acbd$ but I am not sure how to show that", "Create subdomains on the fly with .htaccess (PHP) I am looking to create a system which on signup will create a subdomain on my website for the users account area. e.g. johndoe.website.com I think it would be something to do with the .htaccess file and possibly redirecting to another location on the website? I don't actually know. But any information to start me off would be greatly appreciated. Creating a sign up area is not the problem - I have done this many a time. I am just unsure where to start with the subdomain.", "I have observed that in gedit if I edit a file, another file is created in the same directory (the one with the same filename and a tilde '~' suffix). The extra file remains even if I close gedit. I understand the need for a temp file (eg. in case of a crash), but vim for example deletes the extra file it creates, when I close it. Is there a way to do the same with gedit? Some configuration perhaps?", "How to convert mediawiki syntax to latex?" ]

[ "How do I delete a board when the admin is no longer part of the group? One of our programmers decided to leave us. We took him off the group, but his board that he is the only admin of is still hanging around. How do I remove it?", "Automatically rename files when they are placed in a specific directory Is it possible to automatically rename a file when it's placed in a specific directory? For example I have a directory named \"dir0\".I move or copy a file named \"file1\" to \"dir0\".then \"file1\" should rename to \"file1_{current timestamp}\"", "Haar measure on $SO(n)$ I am interested in describing the group of special orthogonal matrices $SO(n)$ by a set of parameters, in any dimension. I would also like to obtain an expression of the density of the Haar measure in this set of parameters. Could anyone help me on this or indicate a good reference? Thanks", "I had just arrived at the hotel, checked in and gotten into my room. Just as I was about to unpack, I noticed that one of my bags was missing. At first I thought I had left it back at the airport, but it turned out that I had left it on the taxi. Here, what's the meaning and role of \"just\"? Why do you guys input the word \"just\" here? What exactly does the word do grammatically? Could you help me?", "How to clone/copy all file/directory attributes onto different file/directory? I want to copy the attributes (ownership, group, ACL, extended attributes, etc.) of one directory to another but not the directory contents itself. This does not work: cp -v --attributes-only A B cp: omitting directory `A' Note: It does not have to be cp.", "Is there a way to change the process group of a running process? Is there a way to change PID, PPID, SID of a running process? It would make sense for the answer to be no, but I'd like to make sure.", "How to convert date to timestamp in PHP? How do I get timestamp from e.g. 22-09-2008?", "How do I programmatically obtain the version in JBoss AS 5.1?", "What is the motivation for including the compactness and semi-simplicity assumptions on the groups that one gauges to obtain Yang-Mills theories? I'd think that these hypotheses lead to physically \"nice\" theories in some way, but I've never, even from a computational perspective. really given these assumptions much thought.", "How to export debug logs? I spend my days waiting on the Force.com Console and it makes me crazy, I have a pretty nice machine and it still chokes on the details sometimes. Anyways, I saw had given a and is presenting again this year Dreamforce '12. However, it seems like they're presentation is targeted at using their product, or for that matter others like it (, ) on Heroku, and not really targeting APEX/VisualForce development! Is this the case? Are there any better solutions out there for reviewing logs? Are there any APIs that allow you to export your debug logs out of SFDC programatically? Or has anyone even tried to tackle this?", "I need to view the saved WiFi passwords on my non-rooted Android phone I have an LG Optimus 7 (not-rooted), and all my WiFi passwords are there. I want to view the saved WiFi passwords to transfer thm to my new Samsung Galaxy S3, but I don't know how. I tried to search on the Internet and Google play for an application that would allow me to view this information, but I can't find one. Is there any way for me to accomplish this?", "$\\sum_{n=1}^\\infty \\frac{i^n}{n}$ converge?", "The annihilator of a module is an ideal Let $R$ be a ring and let $M$ be an $R$-module. Define the annihilator of $M$ to be the following subset of $R$: $Ann_R(M) =\\{r\\in R \\mid rm = 0_M \\text{ for all } m\\in M \\}$ Prove that $Ann_R(M)$ is an ideal of $R$. please help as much as you can a full answer is greatly appreciated Thanks", "Windows utility to render which key I am pressing on-screen", "Why does default auto.arima stop at (5,2,5)? The function auto.arima in the forecast package of R is a powerful tool to identify the best ARIMA(p,d,q) model for a given data series. In the of the function, they report the following: auto.arima(y, d=NA, max.p=5, max.q=5, max.order=5, max.d=2, start.p=2, start.q=2, ...) According to the above function it seems that, by default, auto.arima tries to find the best model among all the combination having: p equal or lower than 5 q equal or lower than 5 d equal or lower than 2 order equal or lower to 5, i.e. p + q + d ≤ 5. However, why does the default code stops at these conditions? Is there any particular reason why p, q and d should be equal or lower than 5, 5 and 2 and their sum lower than 5?", "Center image element in parent div", "Setting Zero values back to NULL", "I'm running the following script on Ubuntu 14.04: #!/bin/bash apt-get purge -y nginx apt-get install -y nginx date When I run it like cat /tmp/script | bash, apt-get starts installing, then \"date\" is printed (not the actual date, but the command name), then the remaining apt-get output is printed. If however I run the script like /tmp/script, it works as expected: printing the date after apt-get finished. Why does this happen and how can I force bash to work when being piped to the same way it does when invoked directly?", "After doing a \"sudo su -\" on an Ubuntu 12.04 notebook I did a \"crontab -e\", added this: * * * * * env DISPLAY=:0.0 /usr/bin/gnome-calculator and waited for minutes. Nothing Happened. I don't have any external monitors and if I run this command \"env DISPLAY=:0.0 /usr/bin/gnome-calculator\" in the terminal, it just works. But not from cron. Why? The syslog only contains this: May 24 14:37:01 localhost cron[1227]: (root) RELOAD (crontabs/root) May 24 14:37:01 localhost CRON[16432]: (root) CMD (env DISPLAY=:0.0 /usr/bin/gnome-calculator ) And I already tried an \"xhost +localhost\". [root@NOTEBOOK /var/log] xhost access control enabled, only authorized clients can connect INET:localhost.localdomain SI:localuser:USERNAME [root@NOTEBOOK /var/log] So the solution for another question like this on askubunut didn't worked.", "RegEx match open tags except XHTML self-contained tags" ]

[ "If $X$ is a Banach space, and $T:X \\to X$ is a bounded linear operator with norm &lt; $1$, then $I-T$ has a bounded inverse defined by $(I-T)^{-1} = \\sum_{n=0}^\\infty T^n$. Thinking in terms of a converse, if $T$ is any bounded linear operator defined on $X$, then does the existence of a bounded inverse $S=(I-T)^{-1}$ imply that $S$ can be represented as $S=\\sum_{n=0}^\\infty T^n$?", "What is the full \"for\" loop syntax in C?", "Is the possessive of \"one\" spelled \"ones\" or \"one's\"? I've been confused about this as long as I can remember. Should it be: One should do ones duty. or One should do one's duty. I'm guessing it should be the latter. But that doesn't sit well with the possessive pronoun 'its'. For example: It is its own purpose. vs. It is it's own purpose. Here, the former seems clearly correct.", "Verify the identity: $\\tan^{-1} x +\\tan^{-1} (1/x) = \\pi /2$ Verify the identity: $\\tan^{-1} x + \\tan^{-1} (1/x) = \\frac\\pi 2, x &gt; 0$ $$\\alpha= \\tan^{-1} x$$ $$\\beta = \\tan^{-1} (1/x)$$ $$\\tan \\alpha = x$$ $$\\tan \\beta = 1/x$$ $$\\tan^{-1}[\\tan(\\alpha + \\beta)]$$ $$\\tan^{-1}\\left [{\\tan\\alpha + \\tan\\beta\\over 1 - \\tan\\alpha \\tan\\beta} \\right]$$ $$\\tan^{-1}\\left[ {x + 1/x\\over 1- x/x }\\right]$$ $$\\tan^{-1}\\left[{x + (1/x)\\over 0} \\right]$$ I can't find out what I'm doing wrong..", "Two logos in beamer after certain frame I am making a presentation which is devided in two parts. The first part is about experiments held in instute A and the second part is about experiments held in instute A and institute B. Is it possible to add a second logo in a beamer presentation after a certain frame? Let's say that this is a previous slide This is a next slide", "Do Irrationals form a group? It's true that the irrationals do not form a group under addition or multiplication, but I want to find a binary operation \"∗\" such that ($\\mathbb R \\setminus \\mathbb Q,∗$) is a group. It is possible by transpose of operation from $\\mathbb R$, but I want a explicit example.", "Whoever or whomever: 'happy for ___ has the pleasure of working with you next.' So sad to lose you, yet happy for whomever has the pleasure of working with you next.", "How can I disown a running process and associate it to a new screen shell? I have a running program on a SSH shell. I want to pause it and be able to unpause its execution when I come back. One way I thought of doing that was to transfer its ownership to a screen shell, thus keeping it running in there. Is there a different way to proceed?", "I am trying to override the menu.css file in the default Classy theme through my library file. I have read through the documentation, but anything I tried doesn't work. What would be the correct markup to override or disable this file?", "How to install the Pantheon desktop environment?", "How do I reset proxy in terminal to automatic if not connected via proxy I tried to reset proxy of the terminal by some commands but it doesn't happen and automatically switches back to this proxy 172.16.0.16 (which apparently was my college proxy). I checked in my system settings.I don't understand why this is recurring. Please be comprehensive.Also I further would like to know how to bypass proxy server since I couldn't access any of the ubuntu repositories as they were blocked in my college's proxy settings as is Ubuntu's homepage. Thanks for your time. For sudo ls /etc/apt/apt.conf.d/ It displays a different set of options where proxy is not listed.I am on 12.10,if this should help any.I put a snap of the terminal after the above command has been entered.", "Copying prod multi-site installation to dev multi-site installation I am attempting to upgrade my Drupal 8.9.2 multi-site installation to D9. I was hoping to work this all out on a development installation, that is located in a subdirectory of my home directory on my NameCheap Shared Hosting plan. When I first installed this installation, I did so using the tarball method from years ago. I then followed the instructions given here (). I was able to get the current running prod version converted to use composer with out an issue. Before I go and start messing with the files, and attempting to upgrade to D9 through composer on a prod installation, I wanted to copy these files over to another installation where I can use it as a sandbox. To do this I: copied the files on my server to a new directory made clone databases for the new installation truncated all the cache tables in the cloned DB changed all the database settings in the settings files to point to the cloned databases I've done this before without any issues, and now I seem to be getting a WSOD error on all the sites running from the new installation. The error I'm getting is PHP Fatal error: Uncaught Error: Class 'Drupal\\Core\\Cache\\DatabaseBackend' not found in ~/{new installation dir}/public_html/index.php:16. If anyone has any thoughts what's going on I am all ears. Thank you in advance", "Now let set $A$ be arbitrary. So set $A$ exists. Using axiom of pairing $\\{A\\}$ exists. And then using axiom of regularity, we can argue that $A \\notin A$. So, there is some $x$ such that $x \\notin A$. Is this a valid proof ? Thanks", "Do I need a transit visa for a layover in the United Arab Emirates?", "Describe the set of points on the complex plane...", "SELECT name, gdp/population as capita FROM world w1 WHERE continent = 'Europe' AND capita &gt; ( SELECT gdp/population FROM world WHERE name = 'United Kingdom' ); How come I can't refer to capita in the WHERE clause? It returns this error: Unknown column 'capita' in 'where clause' I can however, run the query if I replace capita with gdp/population. I don't want to do gdp/population &gt; .... How can I do capita &gt; ...? Or is this not possible?", "Logo Pack - What should I include?", "Routing Applications sound to different sound device? (Windows)", "Examples of patterns that eventually fail Often, when I try to describe mathematics to the layman, I find myself struggling to convince them of the importance and consequence of \"proof\". I receive responses like: \"surely if Collatz is true up to $20×2^{58}$, then it must always be true?\"; and \"the sequence of number of edges on a complete graph starts $0,1,3,6,10$, so the next term must be 15 etc.\" Granted, this second statement is less logically unsound than the first since it's not difficult to see the reason why the sequence must continue as such; nevertheless, the statement was made on a premise that boils down to \"interesting patterns must always continue\". I try to counter this logic by creating a ridiculous argument like \"the numbers $1,2,3,4,5$ are less than $100$, so surely all numbers are\", but this usually fails to be convincing. So, are there any examples of non-trivial patterns that appear to be true for a large number of small cases, but then fail for some larger case? A good answer to this question should: be one which could be explained to the layman without having to subject them to a 24 lecture course of background material, and have as a minimal counterexample a case which cannot (feasibly) be checked without the use of a computer. I believe conditions 1. and 2. make my question specific enough to have in some sense a \"right\" (or at least a \"not wrong\") answer; but I'd be happy to clarify if this is not the case. I suppose I'm expecting an answer to come from number theory, but can see that areas like graph theory, combinatorics more generally and set theory could potentially offer suitable answers.", "I have just asked a question on I read from this meta answer that suggested From a desktop support perspective there are certainly cases where a large(r) number of machines will be affected by something, in which case it's appropriate for SF. There are then others that are isolated to a single computer, these tend to be the ones I vote to move to SU. Since my question is clearly not about a single computer and is external to a single computer, I turned to ServerFault. I thought the question is about how to replicate a network admin strategy on my own (home) network. My question is, however, marked as off-topic, and I did see that homenetwork questions are off-topic. But this is not a single computer issue either. My question is: Where should such home/small network questions be asked? What's the real difference between \"professional\" networks and the smaller networks that I build for my home or lab with a handful computers? -- UPDATE -- The question asked here is different from the said duplicate question as that question is about the difference among computer science and programming SE sites. It has nothing to do with network administration, whether it's large or small networks. None of the two SE sites in question (Server Fault and Super User) is even mentioned in the question or in the 2 cited answers. -- UPDATE2 -- This question is not a duplicate of , which was cited in the OP and was the cause of this question. That question does not cover the overlapping area of small networks, which could both be for work and for home network." ]

[ "Why do we yawn? I've read a new study which suggests that yawning may help you keep a cool head. Also, the findings might hold some hope for sufferers of insomnia, migraines, and even epilepsy. Is there any conclusion about what the function of yawning is and why do we yawn?", "Vehicles required/allowed in weigh stations on US interstates", "Is it possible to access a static resource of a managed package in your local environment? Thanks", "I have 41 GB of space on my E:/ drive. Is it sufficient to install Ubuntu? My Windows XP is installed in C:/ drive. Is it OK for dual boot? Should I install Ubuntu (I am installing using Live CD). I don't want to lose my Windows option.", "After update, my Thunderbird stopped getting minimized with the \"MinimizeToTray revived\" add-on. Is there any way to minimize my Thunderbird? Any other add-on that works with the new version?", "Can't operator == be applied to generic types in C#?", "How to use mirror ball to light a scene?", "Plot draws list of curves in same color when not using Evaluate", "align vs equation I always use align in my documents, and avoid equation. Is there anything wrong with that? My reasoning behind this: align > equation, so why not use it?", "Can I vent my dryer into the crawl space without creating mold and moisture problems? We have a crawl space with a combination of sandy and clay soil in it. The crawl space is about 3' deep. To eliminate a long dryer vent run, I'd like to vent the dryer directly into the crawl space. We have vents built into the foundation that I open each spring and close in the fall. Will this help dissipate the moisture enough to prevent mold?", "Sneak Damage multiplier: Does it apply to magical damage too? Example: Dagger 1 = 18 Damage, 25 Shock Dagger 2 = 33 Damage, no magic Using the above, when I sneak attack and have the 15x multiple then is the damage caused by Dagger 1 is (18+25)*15 or (18*15)+25 ? Same question with bows and arrows, does the multiplier apply to potion damage or/and the magical(enchanted)? In other words, do the multipliers apply to the base damage only or to the final damage being caused by the weapon (base+magical+skill+potion+perks etc)? I am confused. :-?", "No matter what I do I'm stuck with &gt;. How can I enter a new command? $ chmod -R 600 `/ .ssh &gt; &gt; chmod &gt; id_rsa.pub &gt; &gt; sudo chmod 600 ~/ssh/id_rsa I was trying to sync the master and slave by following a youtube video when I encountered the \"permission denied\" issue. While trying to resolve it I got stuck with &gt;. Now I can't enter any new command. Please guide me. I'm a Linux/AWS newbie.", "When I log in with LightDM on my laptop running Debian Unstable, it recently started to hang for around 2 minutes until journalctl shows the message kernel: random: crng init done. When I press random keys on my keyboard while it hangs, it logs in faster (around 10 seconds). Before I didn't have this issue, is there any way I can fix it? Edit: using linux-image-4.15.0-3-amd64 instead of linux-image-4.16.0-1-amd64 works, but I don't want to use an older kernel.", "SQL IN Clause 1000 item limit", "How long should it take to refresh a Developer Sandbox? I refreshed a Developer Sandbox, and almost 24 hours it is still \"pending\". Is this normal? Are there any actions I can take to speed up the process? When I created the Sandbox it took barely more than 10 minutes to create. Thanks, Adrian", "Possible Duplicate: I was wondering if there's any good reason to still use blob fields in a database. A couple of years ago I worked with a DB with a bunch of images in it, the DB was very slow and I couldn't see any good reason to keep the images inside the DB, so I got the images out and stored the filenames instead. Was this a smart move? What would you do in my place?", "Suppose $G$ is a semigroup and it holds both left and right cancellation. Suppose $G$ is a semigroup and it holds both left and right cancellation. Also for each $a,b\\in G$, $xa=b$ has solution in $G$. Prove G is a group. I know this question looks very \"old\" style. First I think it's easy for me too since I already practice probelems like \"semigroup, $xa=b$ and $ax=b$ have solution , then group\" Or \"finite semigroup, both left and right cancellation hold, then group \". But I still get stuck... My try: First of course, for $xa=a$ , there exists $e_a$ such that $e_aa=a$. Now we need to proof $e_a$ is left identity for all elements. Then left inverse exists hence $G$ is a group. But the key is to proof $e_ab=b$ for all $b\\in G$.", "Is there any actual written dialog for the astromech droids? When R2-D2 and BB-8 converse in The Force Awakens for example, is there any written record of what the two characters were saying to each other? I mean actual dialog, if it exists, and not something like ”BB-8 beeps excitedly”.", "The difference between GPU and CPU I know what a CPU is(I think). It's the thing who's speed is measured in GigaHertz(these days). However, you hear a lot about a GPU, and letting the GPU take over, not letting the CPU but the GPU do it, GPU-based rendering, etc... What is this GPU anyway? How can I access it and use it to my advantage? What am I missing out on here?", "Finding center and radius of circumcircle Find the center and radius of the circle which circumscribes the triangle with (complex) vertices $a_1,a_2,a_3$. Express the result in symmetric form. I'm not sure where to start in this question. The circumcenter is the intersection of the perpendicular bisectors, but I don't know how to calculate the line equation of the perpendicular bisectors yet. As for the radius, after we find the circumcenter $c$ we can calculate it using $|c-a_1|$ (or $|c-a_2|$ or $|c-a_3|$; all three should be equal.) So how can I calculate the circumcenter?" ]

[ "What gear do I need for a newborn photography session? I am an amateur photographer and I have a newborn session coming up for a family friend. My current gear is: Canon T5i (crop sensor) Canon 18-55 IS STM Kit lens 85mm f/1.8 lens I plan on buying a reflector for the shoot and will be using natural light as my light source. So my question is: is this enough gear to get some nice photos? Should I get another prime lens besides the 85mm? I don't really use the kit lens. I also have another 8 month old baby shoot coming up and an informal wedding shoot coming up so it would be nice to use the lenses in all situations. I don't need a telephoto at the moment and will probably not use one any time soon.", "How should I validate an e-mail address?", "How to delete a file with a path too long to be deleted", "Create model from XYZ data points", "How to stop Tkinter Frame from shrinking to fit its contents? This is the code that's giving me trouble. f = Frame(root, width=1000, bg=\"blue\") f.pack(fill=X, expand=True) l = Label(f, text=\"hi\", width=10, bg=\"red\", fg=\"white\") l.pack() If I comment out the lines with the Label, the Frame displays with the right width. However, adding the Label seems to shrink the Frame down to the Label's size. Is there a way to prevent that from happening?", "Shell Script for logging into a ssh server I tried writing a shell script which can do automatic login into a ssh server using password which is mentioned in the script. I have written the following code: set timeout 30 /usr/bin/ssh -p 8484 root@172.31.72.103 expect { \"root@172.31.72.103's password\" { send \"password\\r\" } } This code is not running properly, still it is asking for the password. Can somebody please help me in solving this", "Should form 'Continue' button be disabled if validation is incomplete? In forms we often see the 'continue' button inactive until all the required fields are complete: &ndash; Wireframes created with Is this actually a help to the user, or a hindrance? I imagine the Pro for this is that it's a visual indicator to the user that they haven't finished filling in the form or dealing with errors (because even with inline validation a user won't be informed if they've never actually interacted with a field so won't show any errors for those at that point). But then the main Con for this (which I've also seen borne out in usability testing) is that users will be confused why they can't click the button. Is the pattern of disabling the Continue button until validation is complete actually providing a negative user experience?", "The equivalent electric field of a magnetic field I know that Lorentz force for a charge $q$, with velocity $\\vec{v}$ in magnetic field $\\vec{B}$ is given by $$\\vec{F} =q \\vec{v} \\times \\vec{B}$$ but there will exist a frame of reference where observer move at same velocity with that of charge $q$, so according to him $v=0$. hence he will see no magnetic force is exerted on charge $q$. I have work on this problem for a while and found that the special relativity predicts equivalent electric force will acting upon charge instead. I want to know the relationship between this equivalent electric force and magnetic force. Thanks in advance", "What is the pythonic way to avoid default parameters that are empty lists? Sometimes it seems natural to have a default parameter which is an empty list. Yet . If for example, I have a function: def my_func(working_list=[]): working_list.append(&quot;a&quot;) print(working_list) The first time it is called the default will work, but calls after that will update the existing list (with one &quot;a&quot; each call) and print the updated version. So, what is the pythonic way to get the behavior I desire (a fresh list on each call)?", "What is the best way to remove duplicate rows from a fairly large SQL Server table (i.e. 300,000+ rows)? The rows, of course, will not be perfect duplicates because of the existence of the RowID identity field. MyTable RowID int not null identity(1,1) primary key, Col1 varchar(20) not null, Col2 varchar(2048) not null, Col3 tinyint not null", "C# object references and Action types", "Prison problem: locking or unlocking every $n$th door for $ n=1,2,3,...$ I have a problem called \"The Prison Problem\" that I need to explain to my 9-year-old cousin. I would think that he has just started learning about divisors and perfect squares, and as such, I have a proposed solution. Any input from you guys would be welcome, as to what is the best way to go about this. Problem: There was a jail with 100 cells in it, all in a long row. The warden was feeling very jolly one night and told his assistant that he wanted to give all the prisoners a wonderful surprise. While they were sleeping, he wanted the assistant to unlock all the cells. This should be done, he told the assistant, by putting the key in each lock, turning it once. The assistant did this, then came back to report that the job was done. Meanwhile, however, the warden has second thoughts. \"Maybe I shouldn't let all the prisoners free,\" he said. \"Go back and leave the first cell open, but lock the second one (by putting the key in and turning it once). Then leave the third open, but lock the fourth, and continue in this way for the entire row.\" The assistant wasn't very surprised at this request as the warden often changed his mind. After finishing this task, the assistant returned, and again the warden had other thoughts. \"Here's what I really want you to do,\" he said. \"Go back down the row. Leave the first two cells as they are, and put your key in the third cell and turn it once. Then leave the fourth and fifth cells and turn the key in the sixth. Continue down the row this way.\" The assistant again did as instructed. Fortunately, the prisoners were still asleep. As a matter of fact, the assistant was getting pretty sleepy, but there was no chance for rest yet. The warden changed his mind again, and the assistant had to go back again and turn the lock in the fourth cell and in every fourth cell down the row. This continued all through the night, next turning the lock in every fifth cell, and then in every sixth, and on and on, until on the last trip, the assistant just had to turn the key in the hundredth cell. When the prisoners finally woke up, which ones could walk out of their cells? Proposed solution: Ten cells are left open after this process. Every cell that is a perfect square will remain open (1, 4, 9, 16, 25, 36, 49, 64, 81, and 100). If a number is not a perfect square, then it has an even number of divisors, therefore it will be \"toggled\" an even number of times and end up where it started (closed). Perfect squares have an odd number of divisors, so they will end up the opposite of where they started (open).", "Possible Duplicate: There are several tarballs (e.g. Firefox, Eclipse, Zend Studio and ...) that have executable files in them, that we can extract and run. but this executable will be available only for the user that extracts it. If we want to make it available for all users we should move it to some location like /usr/share, /usr/local/share/, /opt/, ... and give appropriate permissions, make an executable file in /usr/bin/ and so on... I want to make a deb installer file that does them all! How to do it?", "Firefox application associations not working in the 'Downloads' window", "For every vector space $V$ does there exist a linear functional $f$ ( a linear map from $V$ to $F$ the underlying field ) such that for some $ \\vec v \\in V$ , $f(\\vec v) \\ne 0$ ? If it does exist , can we prove the existence without the \"axiom of choice \" ? Is the existence equivalent to axiom of choice ?", "'Should've seen it glow' or 'should've seen it glowing'? Which one of the following is the correct one? I should have seen it glow. I should have seen it glowing. Or are both correct? Would you parse them please?", "Possible Duplicate: I was wondering if there's any good reason to still use blob fields in a database. A couple of years ago I worked with a DB with a bunch of images in it, the DB was very slow and I couldn't see any good reason to keep the images inside the DB, so I got the images out and stored the filenames instead. Was this a smart move? What would you do in my place?", "How do I configure Apache 2 to run Perl CGI scripts? I would like to configure Apache 2 running on Kubuntu to execute Perl CGI scripts. I've tried some steps that I came across by googling, but nothing seems to work. What is the right way of achieving this?", "Edelstein Theorem Let $(M,d)$ be a compact metric space and $d(f(x),f(y)) &lt; d(x,y) $ for all $ x\\neq y$ Prove that if $f$ is a continuous fuction then there is a unique $x_0 \\in M $ such that $f(x_0)=x_0$ I know that since $g(x) = d((f(x),f(y))$ is continuous then a continuous function in a compact space reaches its maximum and minimum. Then by proving that the minimum of $g(x)$ = 0 can I conclude that $x_0$ is a fixed point?", "I'd like to assign a frequently used string to a shortcut key, so when I press it, it types it in whatever application I'm in. So for example, when I type Shift-F12, it types \"This is wonderful!\" in whatever Gnome app I'm in at that time." ]

[ "Why do you cast downvotes on answers? This is a question which started off with a , then turned into an , and now it's a question in its own right (as suggested by Jeff). I'm not sure where it could go from here :) It's obvious that different people cast downvotes for different reasons. (Upvotes are less controversial, generally.) Here are some possible reasons: Answer is wrong Answer is misleading (may be technically accurate, but will lead to readers making mistakes) Answer doesn't match the question (e.g. a C# answer to a question about Java) Answer doesn't really address the question, e.g. suggesting a completely different solution, even if the question specifies that there are good reasons why the current approach has to be followed Answer is okay, but not as good as another one which currently has fewer votes Answer appears to be plagiarised from existing answers. Answer is by someone I don't like. Answer is abusive (profanity, spam etc). No reason, I just felt like it. I'm a , and prefer down to up. Have you considered down? Ideological grounds: answer suggests a technology I don't like, or expresses a negative opinion of a technology I do like Personally I go with 1, 2 and 8 - although I'll add comments suggesting changes in various other situations. Have I missed anything? What do you do, and why? What are the net benefits (to you, the world in general, and the answerer) from your approach?", "Are vacuum fluctuations really happening all the time?", "I've been using the beta iCloud Photo Library for a week and a bunch of photos got duplicated and I'd like to wipe all the photos out and start over. I have backups of all the photos and have turned off iPhoto Cloud Library on all iOS devices. When I log into the web app - it still shows dozens of albums and I can delete all the photos, then go to deleted items and then purge them, but the ghost albums are still there messing things up. I've turned off the library entirely and you can see there is a 30 day waiting period. If I click on albums, there are pages of them and no delete button anywhere. If I turn on the library on an iOS device, data starts flooding back as if I wanted to recover the photos. I don't want to recover anything, I want a clean wipe and clean slate. Currently, there are 7807 photos in the deleted album and no way to mass delete them. I have 31 albums that show up in iCloud and no way to delete them. Is there some way to accelerate this or must people wait a month for a corrupt library to eventually be purged to start over? (I have tickets open with AppleCare after and it's escalated to engineering, but I was informed that it might be a week or two before it gets seen :-( Perhaps someone has a better idea to clear things out or noticed something I've missed.)", "How to use \\graphicspath? I am using MikTex 2.9 and TeXstudio for my TeX preparation. I would like to set the path to my figures folder, which contains all the figures, plots etc. required for my work. I used \\graphicspath to set the directory, but it gives me an error message: \\documentclass[12pt]{article} \\usepackage{graphicx} \\graphicspath{D:/LATEX/Reports@IIT/figures} \\begin{document} \\includegraphics[width=4.5cm,height=4cm,angle=0]{logo.jpg} \\end{document} Error: Package pdftex.def Error: File `logo.jpg' not found However, when I prepend the filenames of the images with the same path in the \\includegraphics command, it works just fine: \\documentclass[12pt]{article} \\usepackage{graphicx} \\begin{document} \\includegraphics[width=4.5cm,height=4cm,angle=0]{D:/LATEX/Reports@IIT/figures/logo.jpg} \\end{document} Why is \\graphicspath not setting the path?", "How to link dataframes in ArcGIS or QGIS? The below image shows a layout in ArcGIS 10.1 with four dataframes. Each dataframe is of the same geographic area, although they are different images. For example, the top left image is a 1989 DOQ, the top right image is a reversed 1989 DOQ, the bottom left image is a 2012 DOQ, and the bottom right image is a reversed 2012 DOQ. Is it possible to link the dataframes so that panning the image in one dataframe pans the images in all of the other dataframes (i.e. similar to how you can \"Link Views\" in Erdas Imagine)? Is this possible in QGIS?", "How to move the center of scaling Hello. I'm a beginner. In the model shown, when I select all of the top vertices and then scale them to the center, the center of scaling is not the center of the 3d-model. How do I move the center of scaling? How do I move the manipulator widget where I want it after selecting?", "Extra }, or forgotten \\right My MWE: \\documentclass{report} \\usepackage{amsmath} \\begin{document} \\begin{align} y &amp;= a \\\\ =&amp; -2c_1\\bar{z}_1^2 + 2\\bar{z}_1\\bar{z}_2 + 2\\bar{z}_2 \\left ( -\\bar{z}_1 -c_2z_2 - \\frac{3\\epsilon}{2}\\bar{z}_2 -\\sigma_{2,1}\\cos(x_1)\\Delta x_1 \\notag \\right. \\\\ \\left. &amp;- \\sigma_{2,2}\\Delta x_2 -\\sigma_{2,3} \\Delta u +c_2 \\chi_2 \\vphantom{\\frac{1}{1}} \\right ) - 2\\gamma \\sigma_{2,1}^2\\cos^2(x_1) \\Delta x_1^2 - \\gamma \\sigma_{2,2}^2 \\Delta x_2^2 - 2\\gamma \\sigma_{2,3}^2 \\Delta u^2 \\end{align} \\end{document} The error I get: Extra }, or forgotten \\right. The expected result:", "Predict() - Maybe I'm not understanding it", "My router can do port-forwarding based on MAC addresses. That is, a specific MAC will get a specific IP, for which I can configure a set of ports to be forwarded. In order to easily change that set of ports, I'd like to have different connections in the Network manager. How do I change the MAC address for a network connection?", "\"Parsing filters unsupported\" error during extraction of RAR file I have received an .rar which I wish to unpack as it contains something rather important to me that I need to really have now. However even though I can view the contents of the .rar archive in the Archive Manager, I am unable to extract it due to this error: The archive should contain two folders within it, each though contain at least 10 audio files as well as a PDF file each (I don't know what the contents exactly should be except for there should be audio files in there, and the content I have described is what I can see from the Archive Manager's view). So the only thing I am left with except the error is one of the folders and one of the audio files, but it says it has 0 bytes in it. So how exactly do I fix this problem? I am running Ubuntu GNOME 16.04.1 with GNOME 3.20. Information Update: In reply to a comment requesting the output from the dpkg -l unrar unrar-free command: Desired=Unknown/Install/Remove/Purge/Hold | Status=Not/Inst/Conf-files/Unpacked/halF-conf/Half-inst/trig-aWait/Trig-pend |/ Err?=(none)/Reinst-required (Status,Err: uppercase=bad) ||/ Name Version Architecture Description +++-==============-============-============-================================= un unrar &lt;none&gt; &lt;none&gt; (no description available) dpkg-query: no packages found matching unrar-free", "Partial vs. Full Volume Wort Boil The starting position for most new extract brewers is to use a partial boil set up. Defined as using a pot smaller than the intended batch size, all the ingredients are boiled in a smaller volume. Then the wort is diluted to the final desired batch size. (Often the dilution step is used as part of a cooling step) What are the Ups and Downs of both Partial vs. Full boils?", "I’ve always understood that the phrase two weeks usually turns into two weeks’ when used as a modifier as in I’m giving my two weeks’ notice. I get two weeks’ vacation. (“two weeks’ holiday” for Brits) with an apostrophe on the word weeks’, indicating that the vacation “belongs” to the weeks. One way to explain this is the phrase “two weeks of vacation” being contracted to “two weeks’ vacation” – the vacation is “of” the weeks; that is, it is possessed by them. But I’ve seen a lot of people omit the apostrophe in casual writing, and thinking about it, it seems plausible that the noun vacation would be plainly modified by the adjectival phrase two weeks. But on the other hand, shouldn’t adjectival phrases be hypenated, namely two-weeks vacation? Yet that seems wrong, too: the hyphenate should be singular, two-week vacation (like two-tone shoes) because . touches on this (and references a good ) but doesn’t explain why the plural must be possessive in this case. suggests that two weeks might be adverbial rather than adjectival, and thus resists being used attributively. But that still doesn’t quite explain this particular muddle of pluralization, possession, and attribution. Given all this, why should “two weeks vacation” be written “two weeks’ vacation” with a possessive apostrophe?", "If $a^3 =a$ for all $a$ in a ring $R$, then $R$ is commutative. Let $R$ be a ring, where $a^{3} = a$ for all $a\\in R$. Prove that $R$ must be a commutative ring.", "Convert integer to hexadecimal and back again", "...where each object also has references to other objects within the same array? When I first came up with this problem I just though of something like var clonedNodesArray = nodesArray.clone() would exist and searched for info on how to clone objects in javascript. I did find a on StackOverflow (answered by the very same @JohnResig) and he pointed out that with jQuery you could do var clonedNodesArray = jQuery.extend({}, nodesArray); to clone an object. I tried this though, this only copies the references of the objects in the array. So if I nodesArray[0].value = \"red\" clonedNodesArray[0].value = \"green\" the value of both nodesArray[0] and clonedNodesArray[0] will turn out to be \"green\". Then I tried var clonedNodesArray = jQuery.extend(true, {}, nodesArray); which deep copies an Object, but I got \"too much recursion\" and \"control stack overflow\" messages from both Firebug and Opera Dragonfly respectively. How would you do it? Is this something that shouldn't even be done? Is there a reusable way of doing this in Javascript?", "Say $R$ is a commutative ring and $I\\in R$ is an ideal. Let us consider the quotient $R/I$. It is created by taking every element $a\\in R$, and adding all the elements of $I$ to it. The elements of $R/I$ are of the form $a+I$ and $b+I$, $\\forall a,b\\in R$. Now $$(a+I).(b+I)=(a+i_{1}).(b+i_{2}),\\forall (i_{1},i_{2})\\in I \\times I$$ $$(a+i_{1}).(b+i_{2})=ab+a.i_{2}+b.i_{1}+i_{1}i_{2}=ab+I$$ We know that $a.i_{2}+b.i_{1}+i_{1}i_{2}\\in I$. If $(a+I).(b+I)=ab+I$, then taking suitable $(i_{1},i_{2})\\in I\\times I$, we should be able to prove $(a+i_{1}).(b+i_{2})=ab+i_{3},\\forall i_{3}\\in I$. However, can every element in $I$ be generated by taking suitable $i_{1},i_{2}\\in I$? And if not, is that the reason why $(a+I).(b+I)$ has to be defined as equal to $ab+I$ in violation of the distributive property of ring elements? This has confused me for a long time. EDIT: I figured addition does not have to be defined as such because $(a+i_{1})+(b+i_{2})=a+b+i_{1}+i_{2}$, where $i_{1}+i_{2}\\in I$. In fact, every element $i\\in I$ can be constructed by taking $i_{1}=0$ and $i_{2}=i$. Hence, $(a+I) + (b+I)=a+b+I$ naturally. This is the logic I followed to determine that $(a+I).(b+I)$ doesn't quite work as nicey. I'm not sure if this logic is flawed or not as I haven't had the opportunity to ask anybody. Thanks for your help in advance!", "Model Selection: Logistic Regression", "Why is everybody so concerned about etc/passwd? Here is the content of my vagrant machine of this particular file: root:x:0:0:root:/root:/bin/bash daemon:x:1:1:daemon:/usr/sbin:/usr/sbin/nologin bin:x:2:2:bin:/bin:/usr/sbin/nologin sys:x:3:3:sys:/dev:/usr/sbin/nologin sync:x:4:65534:sync:/bin:/bin/sync games:x:5:60:games:/usr/games:/usr/sbin/nologin man:x:6:12:man:/var/cache/man:/usr/sbin/nologin lp:x:7:7:lp:/var/spool/lpd:/usr/sbin/nologin mail:x:8:8:mail:/var/mail:/usr/sbin/nologin news:x:9:9:news:/var/spool/news:/usr/sbin/nologin uucp:x:10:10:uucp:/var/spool/uucp:/usr/sbin/nologin proxy:x:13:13:proxy:/bin:/usr/sbin/nologin www-data:x:33:33:www-data:/var/www:/usr/sbin/nologin backup:x:34:34:backup:/var/backups:/usr/sbin/nologin list:x:38:38:Mailing List Manager:/var/list:/usr/sbin/nologin irc:x:39:39:ircd:/var/run/ircd:/usr/sbin/nologin gnats:x:41:41:Gnats Bug-Reporting System (admin):/var/lib/gnats:/us$ nobody:x:65534:65534:nobody:/nonexistent:/usr/sbin/nologin syslog:x:100:103::/home/syslog:/bin/false Could anybody explain me why it is bad if some evil guy could get this file of my production server?", "How to prove that we are living in a 3+1D world? Is there any scientific experiment that can lead us to conclude we live in 3 spatial dimensions without the premise of the conception of limited dimensions? Thank you all who helped in the improvement of this question (which was not clear at first). EDIT: I know that this can be a little philosophical, but it is also a scientific question. Let's consider the scenario where the mankind was not ever able to see. Let's also consider that this limitation could be surpassed thus not limiting us to reach a scientific and technological knowledge \"similar\" to what we have today. Would this civilization of blind people reach the conclusion that they are living in a 3D spatial world? Is the sense of touch enough to reach that conclusion? Is there any scientific experiment that can lead us to that conclusion without the premise of the conception of limited dimensions? Would it be easier, harder, or just different to reach a conclusion predicted by the M-Theory? (please do not focus only on this last question)", "How do I implement a draggable tab using Java Swing? Instead of the static JTabbedPane I would like to drag-and-drop a tab to different position to rearrange the tabs. EDIT: ." ]

[ "Convert string to Title Case with JavaScript", "Which Harry Potter works are considered canon?", "\"I\", \"me\" and \"myself\" Possible Duplicate: What is correct? We are a family of four: my father, my mother, my brother and me. or We are a family of four: my father, my mother, my brother and I. or We are a family of four: my father, my mother, my brother and myself.", "Phone Call On TextView Click", "Setting chain length My chain broke and in a moment of silliness (I was cold wet and slightly annoyed) I threw the broken one away before thinking about measuring the new one. Is there a guide to getting the chain length/tension correct ? It's an 8 speed road bike (Shimano Sora back, double ring front)", "How did half of Darth Maul survive?", "If I push or hit an object in space will it rotate or move along a straight line?", "Multigroup (CCK3) / FlexiField-like solution for compound fields? I've used in the past to do multiply occurring series of field groups; now, working on a Drupal 7 project, I'm setting up a \"Resume\" content type and need a way to set up repetitive entries for education/work experience. IE: for \"Education\", I need the ability to dynamically add new rows comprised of a combination of dates and places for each institution studied at. What is the best way to accomplish CCK3 multigroup/FlexiField-like functionality in Drupal 7? Thanks!", "Proof that $\\mathrm{ker}(f^*) = \\mathrm{im}(f)^{\\perp} $ Where $ f: V \\rightarrow V $ is a linear operator on an inner product space $V$, I'm trying to show that $$ \\mathrm{ker}(f^*) = \\mathrm{im}(f)^{\\perp} $$ i.e. the Kernel of the adjoint is equal to the orthogonal complement of the image of f. I taking the inner product of $f(v)$, where $v \\in V$ and an arbitary element of the kernel, $k \\in \\mathrm{ker}(f^*) $ $$\\langle f(v), k\\rangle = \\langle v, f^*(k)\\rangle = \\langle v, 0\\rangle = 0$$ And then taking the inner product of $f(v)$ with $w$, where $w \\in \\mathrm{im}(f)^{\\perp}$ By definition of the orthogonal complement to the image of f, $$ \\langle f(v), w\\rangle = 0 $$ My question is, now that we have $$ \\langle f(v), k\\rangle = \\langle f(v), w\\rangle = 0 $$ What can we conclude? I would like to conclude that because $w$ and $k$ are arbitary elements of their respective subspaces, that these must be equal, i.e. $ \\mathrm{ker}(f^*) = \\mathrm{im}(f)^{\\perp} $ However, I am not sure this is mathematically sound, is that conclusion valid or are there any technical barriers or additional statements that would have to be made to make that watertight?", "Find an equation in spherical coordinates for the surface represented by the rectangular equation The rectangular equation is $$x^2+y^2-8z^2=0$$ $$x^2+y^2=8z^2$$ Know in the relationship between rectangular and spherical coords. we can manipulate our given to fit the form: $$x^2+y^2+z^2=9z^2$$ $$\\rho=x^2+y^2+z^2, \\space z=\\rho\\cos(\\phi)$$ $$\\rho^2=9\\rho^2\\cos^2(\\phi)$$ $$1=9\\cos(\\phi)$$ $$\\frac{1}{3}=\\cos(\\phi)$$ $$\\arccos(\\frac{1}{3})=1.23 \\space rads$$ And so the equation in spherical coords. is $\\phi=1.23$ I know my math is correct but I have the wrong answer so I'm not sure where I went wrong.", "Redefining \"cited on\" string (and others) in biblatex", "\"Started to work\" vs \"Started working\"", "When your 10-year old boy says “It’s meta,” what does it mean? In what situation and of what sort of object they use this phrase? I asked about a few days ago, quoting Maureen Dowd’s review of the movie, “J. Edgar” in New York Times. I received six answers. But I still don’t get a clear idea of what “It’s meta” means because I don't understand (or have a total inability to comprehend) the concept of “self-referential.” An answerer : “Meta in this fairly recent, casual context is supposed to mean self-referential, or recursive in some way. This is the sense in which my teenagers would use this term.” So let me resubmit the question on “meta” in simpler format. When your teenager boy says “It’s (or this is) meta,” what does it mean? In what situation and of what sort of object they use this phrase? I’m sorry for many users who lent me kind answers to my previous question. But I would like to get it fully on the meaning and usage of “it’s meta,” as a colloquial expression, not the meaning of meta as a prefix.", "I have already proved Triangle Inequality $\\lVert v+w\\rVert \\le \\lVert v \\rVert+\\lVert w \\rVert$ in vector space $\\mathbb{R}^n$. However, I'm having difficulties proving the Reverse Triangle Inequality in the vector space. I have started with $$\\lVert v \\rVert^2=v \\cdot v-w\\cdot w+w\\cdot w \\le \\lVert v-w \\rVert+\\lVert w \\rVert^2$$ $$\\lVert w \\rVert^2=w \\cdot w-v\\cdot v+v\\cdot v \\le \\lVert w-v \\rVert+\\lVert v \\rVert^2$$ based on the Triangle Inequality but I don't know if it is correct. If this is right, I think I can go on with proving it the same way I would the normal Reverse Triangle Inequality.", "A Product function for matrix products", "What is a good word to describe someone who is empathetic, quick, and witty in conversation", "Given an integer $n$, we are asked to investigate about the existence of integer divisors of $n^2+1$ of the form $4k+3$. Can you provide some insights about it?", "Why do people go to the Wall in Game of Thrones? Is the wall a bad or a good place to be? Some people are sent there as punishment, others go because they want to (Jon Snow), others to get away from harm (Arya). If I am not completely correct, it is because I have only started watching the series recently, and it is a bit confusing! Please also correct me if I am wrong with any facts!", "Subtracting (erasing) polygons from polygon using ArcGIS for Desktop? I have two polygon layers, one is green that represents all non-public right-of-way land. I have another polygon that is just a circle with a specified radius. I would like my output to be a polygon layer that represents all the white space (the gaps) in the private land polygon layer that is also within the black circle. How does one do this (In ArcGIS 10.2)?", "For $p,q$ prime and $p \\neq q$ show that $C_p \\times C_q \\cong C_{pq}$ Here are my thoughts so far: $C_p = \\langle x \\mid x^p =e\\rangle$ $C_q = \\langle y \\mid y^q =e\\rangle$ $C_p \\times C_q$ has elements of the form $(x^a,y^b)$ There are $p$ possible values for $x^a$ and $q$ possible values for $y^b$. So there are $pq$ possible elements in $C_p \\times C_q$. $C_{pq} = \\langle z\\mid z^{pq} = e\\rangle$ and there are $pq$ elements in this group. For an isomorphism from $C_p \\times C_q$ to $C_{pq}$ we send $(e,e)$ to $e$ to ensure that the identities are mapped to each other. However, I'm not sure how to define an isomorphism for the other elements." ]

[ "Move object in inches instead of feet? Whenever I move an object in blender in unit mode(Imperial), it always make it in feet. For example, if I type G Y 12, it will move 12 feet. How can I make it move 12 inches instead?", "Consider $\\mathbb R^{[0,1]}$ the space of all functions from $[0,1]$ to $\\mathbb R$ and the cylindrical sigma algebra $\\mathcal B$ on it. The question is: how to prove that $C[0,1]\\notin \\mathcal B$.", "Sometimes you see a video of a fan or a propeller spinning very fast, and the apparent rotation is distorted. The fan can appear to be moving in the opposite direction of rotation, or even stationary. This optical illusion is known as the wagon-wheel effect. If I understand correctly, this occurs because the camera framerate is slower than the frequency at which the fan makes one rev, so stroboscopic effects should be expected. Does the wagon-wheel effect occur only in videos, or can we observe it just with the eye?", "Graphing y=x^2 and y=x", "ERROR: cuvid requested, but not all dependencies are satisfied: cuda/ffnvcodec I am trying to compile FFMPEG with Nvidia Cuda support, on Debian 9.3. Parameters, what I am using: --enable-cuda --enable-cuvid --enable-nvenc --extra-cflags=-I/usr/local/cuda/include --extra-ldflags=-L/usr/local/cuda/lib64 --enable-gpl --enable-libx264 --disable-x86asm --enable-libx265 --enable-libfdk-aac --enable-nonfree Nvidia Cuda with drivers are installed. When I try to configure ffmpeg, it says: ERROR: cuvid requested, but not all dependencies are satisfied: cuda Newer ffmpeg will show a similar, re-worded message: ERROR: cuda requested, but not all dependencies are satisfied: ffnvcodec I absolutely don't know why I'm having this issue, because I am compiling ffmpeg on all of our trans-coding servers.", "Let $(B_t)_{t\\geq 0}$ be a standard Brownian motion in $\\mathbb{R}^d$. It is intuitive that, for fixed $s&lt;t&lt;u$ $$\\mathbb{E}[B_t\\mid \\sigma(B_s,B_u)]=B_s+\\frac{t-s}{u-s}(B_u-B_s).$$ However, I cannot think of a way to show this rigorously. If first attempted to take $A\\in\\sigma(B_s,B_u)$ and show that $\\mathbb{E}[1_A B_t]=\\mathbb{E}[1_A(B_s+\\frac{t-s}{u-s}(B_u-B_s))]$. But I cannot manage to show this equality. I'd be very thankful for any ideas and suggestions on how to tackle this problem.", "Get name of caller function in PHP? Is there a PHP function to find out the name of the caller function in a given function?", "Install on, install in, install to When I say \"programs to install on a new PC\" it sounds alright to me, but I'm not sure if it's the correct usage. Which one of the following should I use? Programs to install on a new PC Programs to install in a new PC Programs to install to a new PC", "Taking the * of these two large shapefiles locally using ArcMap takes appr. 10 min. Over the last few weeks, I've tried to obtain the same results using other, open-source approaches without success. I am curious why only ArcMap seems to generate results in a reasonable amount of time without errors. The approaches I've tried so far: QGIS The most straight-forward alternative. There are two \"union\" functions available in QGIS. One default (part of vector overlay), one based on SAGA. Both functions create the desired results on smaller samples but fail to run (or take forever) on my shapefiles. I tried running union for 30 minutes after which the progress bar was at appr. 4% PostGIS I've ingested the shapefiles on an AWS RDS instance running postGreSQL with PostGIS enabled. The approach is not so straight forward and requires a hideous long SQL query to obtain the same result. Most importantly, the query did not create a meaningful result on the full datasets. It did run properly on a sample though. See separate question CREATE TABLE test.sqlislelijk AS -- input data with polys1 AS ( SELECT pfaf_id as df1, geom as g FROM hybas06_v04 ), polys2 AS ( SELECT aqid as df2, geom as g FROM y2018m11d14_rh_whymap_to_rds_v01_v01 ), -- intersections intersections AS ( SELECT df1, df2, ST_INTERSECTION(a.g, b.g) i, a.g AS g1, b.g AS g2 FROM polys1 a, polys2 b WHERE ST_INTERSECTS(a.g, b.g) ), -- per-row union of intersections with this row diff1 AS ( SELECT df1, ST_UNION(i) i FROM intersections GROUP BY df1 ), diff2 AS ( SELECT df2, ST_UNION(i) i FROM intersections GROUP BY df2 ), -- various combinations of intersections pairs AS ( SELECT df1, df2, i AS g FROM intersections UNION ALL SELECT p.df1, NULL, CASE WHEN i IS NULL THEN g ELSE ST_DIFFERENCE(g, i) END FROM polys1 p LEFT JOIN diff1 d ON p.df1 = d.df1 UNION ALL SELECT NULL, p.df2, CASE WHEN i IS NULL THEN g ELSE ST_DIFFERENCE(g, i) END FROM polys2 p LEFT JOIN diff2 d ON p.df2 = d.df2 ) SELECT df1 as pfaf_id, df2 as aqid, g as geom FROM pairs WHERE NOT ST_IsEmpty(g); Google BigQuery Google's GIS extension for BQ looks promising but I experienced weird behavior and internal errors, probably due to mixing of GEOMETRY and GEOGRAPHY objects. Also, the syntax is similar to PostGIS and a command of 1 line in geopandas takes >20 lines in SQL. GeoPandas Probably my favorite approach. The out-of the box approach does't give any results after running it for several hours. My latest approach includes tiling the shapefiles, use multiprocessing on each tile and merge them. Not very straight forward and one 10x10 degree tile till takes 40+ minutes to calculate. See It is the first time in my career that I am impressed by the performance of ArcMap. It seems that ArcMap handles this use-case much, much better than anything else. The issue seems persistent over all solutions I've tried so far. Is there something wrong in the underlying libraries of the open-source/alternative solutions? Note that Union in ArcMap means something different than in the Shapely / PostGIS world.", "What is the sign of the work done on the system and by the system? What is the sign of the done on the system and by the system? My chemistry book says when work is done on the system, it is positive. When work is done by the system, it is negative. My physics book says the opposite. It says that when work is done on the system, it is negative. When work is done by the system, it is positive. Why do they differ?", "TexShop will not compile without trashing aux files after every error I have a couple of LaTeX files with the same problem. If I produce an error, fix it, and then try to compile a pdf, I get the following error. )Runaway argument? {{ ! File ended while scanning use of \\@newl@ablel. &lt;inserted text&gt; \\par l.90 \\begin{document} If I then click on the console or trash my .aux file, it compiles fine. Any thoughts on what is going on and how to prevent this annoying extra step?", "How to find $ \\int_0^\\infty \\dfrac x{1+e^x}\\ dx$", "How do you report percentage accuracy for glmnet logistic regression?", "As far as I know, humans have 23 pairs of chromosomes, each one which contains a particular amount of genes. But in the \"last\" pair, men have a XY pair chromosome, and women have a XX pair chromosome. Does the missing \"leg\" of the XY pair make men to have fewer genes than women, and if so, how many genes do each sex have?", "What would you see if you have 2 huge mirrors (you cant look over it or next to it) You place them with the reflecting side to each other and you look in the mirror from behind one mirror (one way mirror = 1 side glass 1 side mirror, like in a movie when cops are questioning a suspect.) The mirror would reflect each other endless. The example could be preformed with a see trough mirror (1 side mirror other side glass) but I don't have one, also I don't have huge mirrors. Would it make a diffrence if you place a light source and if you dont have a light source? My guess is that you would always see black because there is nothing to mirror. Edit important: There is nothing in the room to reflect on, so it only reflects the mirror, thats what i ment.", "How to reinstall Ubuntu in dual boot with Windows 10? I have Ubuntu 15.10 and Windows 10 dual-booted, but I want to reinstall Ubuntu in the same partition without making any changes or causing problems in the dual boot option and without removing Windows. Is it possible? Any guide on how to do it?", "Is there a way to send a file using POST from a Python script?", "Is there a way to determine how many digits a power of 2 will contain? Is there a direct way to determine how many digits a power of 2 will contain without actually performing the multiplication? An estimation would help as well if there is no absolute solution. EDIT: In both decimal and binary bases.", "I'm sure there is a really simple explanation to this but haven't found any pointers on this forum or elsewhere. I seem to have lost the 'processing' menu from QGIS and can't figure out how/why!? Any ideas what I might have done to make this happen? I'm running QGIS 2.8 built against GDAL 1.10 on Ubuntu 14.04.", "mysqli or PDO - what are the pros and cons? In our place we're split between using mysqli and PDO for stuff like prepared statements and transaction support. Some projects use one, some the other. There is little realistic likelihood of us ever moving to another RDBMS. I prefer PDO for the single reason that it allows named parameters for prepared statements, and as far as I am aware mysqli does not. Are there any other pros and cons to choosing one over the other as a standard as we consolidate our projects to use just one approach?" ]

[ "I see the following error while trying run the command shown below. I read somewhere that my /boot partition is low on disk space. How can I increase the size of the /boot partition so I can install more software? I have a 500GB hard disk, so there is enough space to play with. sudo apt-get install libdvdread4 gzip: stdout: No space left on device E: mkinitramfs failure cpio 141 gzip 1 update-initramfs: failed for /boot/initrd.img-3.2.0-33-generic with 1. run-parts: /etc/kernel/postinst.d/initramfs-tools exited with return code 1 Failed to process /etc/kernel/postinst.d at /var/lib/dpkg/info/linux-image-3.2.0-33-generic.postinst line 1010. dpkg: error processing linux-image-3.2.0-33-generic (--configure): subprocess installed post-installation script returned error exit status 2 dpkg: dependency problems prevent configuration of linux-image-server: linux-image-server depends on linux-image-3.2.0-33-generic; however: Package linux-image-3.2.0-33-generic is not configured yet. dpkg: error processing linux-image-server (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-server: linux-server depends on linux-image-server (= 3.2.0.33.36); however: Package linux-image-server is not configured yet. dpkg: error processing linux-server (--configure): dependency problems - leaving unconfigured No apport report written because the error message indicates its a followup error from a previous failure. No apport report written because the error message indicates its a followup error from a previous failure. Errors were encountered while processing: linux-image-3.2.0-33-generic linux-image-server linux-server N: Ignoring file 'michael-gruz-canon-precise.list.1' in directory '/etc/apt/sources.list.d/' as it has an invalid filename extension N: Ignoring file 'michael-gruz-canon-precise.list.1' in directory '/etc/apt/sources.list.d/' as it has an invalid filename extension Listed below is the output of du Filesystem 1K-blocks Used Available Use% Mounted on /dev/mapper/ubuntu-root 712660664 104095912 572363692 16% / udev 3964792 4 3964788 1% /dev tmpfs 1591012 1064 1589948 1% /run none 5120 0 5120 0% /run/lock none 3977528 684 3976844 1% /run/shm /dev/sda1 233191 219821 929 100% /boot", "I wanted to tweet something on the lines of \"Stack&nbsp;Overflow is awesome\". When I do this kind of stuff, I usually use a username (for example: ) or a hashtag () I found , but it seems it is from someone unrelated with Stack&nbsp;Overflow. Is there a Twitter account I can reference, or should I use a hash-tag? Should I just point to the site? Thanks! (Notice: I've seen lots of questions regarding Twitter and Stack&nbsp;Overflow, but those are mostly about integration/login with Twitter for the users accounts; I'm just asking for a single account for Stack&nbsp;Overflow; probably for announcements and PR, which is different)", "Inverse of a Positive Definite Let K be nonsingular symmetric matrix, prove that if K is a positive definite so is $K^{-1}$ . My attempt: I have that $K = K^T$ so $x^TKx = x^TK^Tx = (xK)^Tx = (xIK)^Tx$ and then I don't know what to do next.", "How does Cantor's diagonal argument work? I'm having trouble understanding Cantor's diagonal argument. Specifically, I do not understand how it proves that something is \"uncountable\". My understanding of the argument is that it takes the following form (modified slightly from the article, assuming base 2, where the numbers must be from the set $ \\lbrace 0,1 \\rbrace $): \\begin{align} s_1 &amp;= (\\mathbf{0},1,0,\\dots)\\\\ s_2 &amp;= (1,\\mathbf{1},0,\\dots)\\\\ s_3 &amp;= (0,0,\\mathbf{1},\\dots)\\\\ \\vdots &amp;= (s_n \\text{ continues}) \\end{align} In this case, the diagonal number is the bold diagonal numbers $(0, 1, 1)$, which when \"flipped\" is $(1,0,0)$, neither of which is $s_1$, $s_2$, or $s_3$. My question, or misunderstanding, is: When there exists the possibility that more $s_n$ exist, as is the case in the example above, how does this \"prove\" anything? For example: \\begin{align} s_0 &amp;= (1,0,0,\\mathbf{0},\\dots)\\ \\ \\textrm{ (...the wikipedia flipped diagonal)}\\\\ s_1 &amp;= (\\mathbf{0},1,0,\\dots)\\\\ s_2 &amp;= (1,\\mathbf{1},0,\\dots)\\\\ s_3 &amp;= (0,0,\\mathbf{1},\\dots)\\\\ s_4 &amp;= (0,1,1,\\mathbf{1},\\dots)\\\\ s_4 &amp;= (1,0,0,\\mathbf{1},\\dots)\\ \\ \\textrm{ (...alternate, flipped } s_4\\textrm{)}\\\\ s_5 &amp;= (1,0,0,0,\\dots)\\\\ s_6 &amp;= (1,0,0,1,\\dots)\\\\ \\vdots &amp;= (s_n \\text{ continues}) \\end{align} In other words, as long as there is a $\\dots \\text{ continues}$ at the end, the very next number could be the \"impossible diagonal number\", with the caveat that it's not strictly identical to the \"impossible diagonal number\" as the wikipedia article defines it: For each $m$ and $n$ let $s_{n,m}$ be the $m^{th}$ element of the $n^{th}$ sequence on the list; so for each $n$, $$s_n = (s_{n,1}, s_{n,2}, s_{n,3}, s_{n,4}, \\dots).$$ ...snip... Otherwise, it would be possible by the above process to construct a sequence $s_0$ which would both be in $T$ (because it is a sequence of 0s and 1s which is by the definition of $T$ in $T$) and at the same time not in $T$ (because we can deliberately construct it not to be in the list). $T$, containing all such sequences, must contain $s_0$, which is just such a sequence. But since $s_0$ does not appear anywhere on the list, $T$ cannot contain $s_0$. Therefore $T$ cannot be placed in one-to-one correspondence with the natural numbers. In other words, it is uncountable. I'm not sure this definition is correct, because if we assume that $m = (1, \\dots)$, then this definition says that \"$s_n$ is equal to itself\"&mdadsh;there is no \"diagonalization\" in this particular description of the argument, nor does it incorporate the \"flipping\" part of the argument, never mind the fact that we have very clearly constructed just such an impossible $T$ list above. An attempt to correct the \"diagonalization\" and \"flipping\" problem: $$s_n = (\\lnot s_{m,m}, \\lnot s_{m,m}, \\dots) \\quad \\text{where $m$ is the element index and} \\quad\\begin{equation}\\lnot s_{m,m} = \\begin{cases}0 &amp; \\mathrm{if\\ } s_{m,m} = 1\\\\1 &amp; \\mathrm{if\\ } s_{m,m} = 0\\end{cases}\\end{equation}$$ This definition doesn't quite work either, as we immediately run in to problems with just $s_1 = (0),$ which is impossible because by definition $s_1$ must be $ = (1)$ if $s_1 = (0)$, which would also be impossible because... Or more generally, with the revised definition there is a contradiction whenever $n = m$, which would seem to invalidate the revised formulation of the argument / proof. Nothing about this argument / proof makes any sense to me, nor why it only applies to real numbers and makes them \"uncountable\". As near as I can tell it would seem to apply equal well to natural numbers, which are \"countable\". What am I missing?", "If $f \\circ g$ is surjective, then f is surjective Let $f: X \\rightarrow Y$ and $g: Y \\rightarrow X$ If $f \\circ g$ is surjective, then f is surjective, too. I think that is true. Question: How can I proove that? I have so far: $\\forall y \\in Y: \\exists x \\in X : f(x)=y$ $\\forall x \\in Y : \\exists y \\in Y : f \\circ g(y)= x$", "Unsupervised learning for anomaly detection I've started working on an anomaly detection in Python. My dataset is a time series one. The data is being collected by some sensors which record and collect data on semiconductor making machines. My dataset looks like this: ContextID Time_ms Ar_Flow_sccm BacksGas_Flow_sccm 7289973 09:12:48.502 49.56054688 1.953125 7289973 09:12:48.603 49.56054688 2.05078125 7289973 09:12:48.934 99.85351563 2.05078125 7289973 09:12:49.924 351.3183594 2.05078125 7289973 09:12:50.924 382.8125 1.953125 7289973 09:12:51.924 382.8125 1.7578125 7289973 09:12:52.934 382.8125 1.7578125 7289999 09:15:36.434 50.04882813 1.7578125 7289999 09:15:36.654 50.04882813 1.7578125 7289999 09:15:36.820 50.04882813 1.66015625 7289999 09:15:37.904 333.2519531 1.85546875 7289999 09:15:38.924 377.1972656 1.953125 7289999 09:15:39.994 377.1972656 1.7578125 7289999 09:15:41.94 388.671875 1.85546875 7289999 09:15:42.136 388.671875 1.85546875 7290025 09:18:00.429 381.5917969 1.85546875 7290025 09:18:01.448 381.5917969 1.85546875 7290025 09:18:02.488 381.5917969 1.953125 7290025 09:18:03.549 381.5917969 14.453125 7290025 09:18:04.589 381.5917969 46.77734375 What I have to do is to apply some unsupervised learning technique on each and every parameter column individually and find any anomalies that might exist in there. The ContextID is more like a product number. I would like to know which unsupervised learning techniques can be used for this kind of task at hand. Thanks", "What is the correct possessive for nouns ending in \"‑s\"? What is the possessive of a noun ending in ‑s? Are these both right, or is the second one wrong? the boys' books the boss' car", "Number of ring homomorphisms from $\\mathbb Z_{12}$ to $\\mathbb Z_{28}$. Question: Find the number of non trivial ring homomorphisms from $\\mathbb Z_{12}$ to $\\mathbb Z_{28}$. ($f$ is not necessarily unitary, i.e., $f(1)$ need not be $1$.) Suppose $f$ is a ring homomorphism from $\\mathbb Z_{12}$ to $\\mathbb Z_{28}$. Consider $f$ as a additive group homomorphism. Let $k= |\\ker f|$ and $ t = |\\operatorname{im}(f)|$. Then $k\\mid 12$ and $t\\mid 24$ and $kt=12$, by first isomorphism theorem of groups. There are two possibilities $k=3$, $t=4$ and $k=6$, $t=2$. For the first case $f$ should map $1$ to an element of the subgroup generated by $7$ as there is a unique subgroup of $\\mathbb Z_{28}$ of order $4$ generated by $7$. For the second case $1$ has to map to $14$, for the same reasoning. So there are at most two ring homomorphisms from $\\mathbb Z_{12}$ to $\\mathbb Z_{28}$. Question is how to check the possible maps which are ring homomorphisms. Thanks.", "How does iCloud Photo Library's \"Optimize iPhone Storage\" setting work in relation to other photo apps on iOS? If I have Optimize iPhone Storage enabled on my iPhone and my phone storage is completely full, I understand that iOS will only store a low-res thumbnail of many of my photos on the device. (The full high-res version of the image will only exist in iCloud and on devices with Download and Keep Originals enabled.) But when only thumbnails exist on the device, how does that work in relation to other photo apps on iOS? For example, do third-party cloud-based photo apps (like Google Photos, Dropbox's Carousel, or Amazon Prime Photos) have access to the full high-res images from the iCloud Photo Library? Or will they only see the low-res thumbnails in some cases?", "80's/90's movie: man and woman driving through a red desert planet", "How did nobody at Hogwarts (especially Dumbledore) figure out what killed Myrtle? The information is all clearly there, since Harry and Ron, two 12-year-olds, were able to figure it out (with a bit of help from a petrified Hermione), thought at the time Aragog was much younger and smaller and wouldn't have been as easy to find, so maybe the \"spiders flee before it\" clue would have been lost, although to be honest it's not exactly as vital a piece of the puzzle as the others. Dumbledore himself is obviously a very capable and intelligent Wizard, and after Myrtle died she came back as a ghost and was able to provide (admittedly limited) details of her own death. I don't know about you, but I'd have thought at least someone would have tried to piece it together at the time, and it wouldn't have taken them long to figure out \"Oh, she saw a pair of big yellow eyes after hearing a boy speak a funny language in the bathroom and dropped dead? Sounds like she might have heard somebody order a Basilisk to look her in the eyes in parseltongue\", especially if the investigator in question was someone like Dumbledore. Do we have any info on why nobody seemed to have found out anything in 50 years prior to Harry Potter (and, probably more importantly, Hermione Granger) turning up at Hogwarts?", "Compute the radius of convergence of the power series $\\sum_{n=0}^{\\infty} n!x^n$", "In Star Trek canon, what's the range of operation of Transporters? By \"range of operation\" of the transporter, I mean \"distance up to which it could transport\" or \"distance from which it could transport something to its own location\". The range of operation would have increased with time without a doubt but I want to know the average range at any period. It'll be better if you provide full stats of all times.", "It's not like there's anything else to do. Shouldn't the speaker say: \"There's something else to do.\" ? so what's the meaning of the sentence and what's the difference between the two of them? Thank you,", "Can you turn weather off in Minecraft?", "I have been experiencing an issue that once I have a material created and looking the way I want it, I cannot seem to export it correctly with the textures mixed. I don't know the correct words to use, but in blender I have the material created using the nodes editor, and I have placed two textures inside of there (one for the rock texture and one for moss, my object is a rock). When I export this model and import to Unity (the game engine I am using), I find a materials folder but the material inside of it does not have the textures assigned, it's just a plain white material? How can I export my material from blender in a way that it will allow me to import it WITH TEXTURES into Unity?", "tikz arc with -latex arrow tip Why the arc does not fit over the circle if we use -latex arrow tip? Maybe some bug or some bad math computations? MWE \\documentclass[11pt,margin=2pt]{standalone} \\usepackage{tikz} \\usetikzlibrary{arrows.meta} \\begin{document} \\begin{tikzpicture} \\draw (0:1cm) arc (0: 180:1cm) arc (180:0:1cm and 2cm); \\draw (0:1cm) arc (0:-180:1cm); \\draw[-&gt;] (0:1cm) arc (0: 80:1cm); \\draw[-latex] (0:1cm) arc (0:- 80:1cm); \\end{tikzpicture} \\end{document}", "How can an 18 month old be taught that bullying is not ok? He seems to like causing the trouble it brings upon him, and bullying, mean acts also seem to please him. He likes to sit on his younger cousin (my son), push him down, and steal his toys. His parents seem to be at a loss about it, and I don't really have any good suggestions to give. Thanks.", "showing $\\psi: R\\to \\mathbb C$ is ring isomorphism.", "Is the tabu package obsolete?" ]

[ "I wonder whether it is possible to perform within R a clustering of data having mixed data variables. In other words I have a data set containing both numerical and categorical variables within and I'm finding the best way to cluster them. In SPSS I would use two - step cluster. I wonder whether in R can I find a similar techniques. I was told about poLCA package, but I'm not sure ...", "they were question banned; it turned out it (in part) it was because of deleted questions. was deleted by the Community user. I'm aware it will delete old posts that have a negative score, but for a minute or two, I was really puzzled as to why it was unilaterally deleted without some notation left. Can we have the Community user leave a notation in a post's history as to why the post was deleted? Something like the following would suffice: Post deleted automatically due to having negative votes and no activity for three months", "\"A/An\" preceding a parenthetical statement", "Deleting Individual SE Accounts", "Stop asking me if Community auto-flags were helpful", "What does a leading zero do for a php int?", "How do I properly install a system app given its .apk? I removed a system app (com.android.mms) and I have the .apk needed to restore it, however it won't install through the standard channels (running the .apk gives me \"application not installed\"). What's the proper way to install a system app's .apk?", "Have red shifted photons lost energy and where did it go? I think the title says it. Did expansion of the universe steal the energy somehow?", "Simplify result of $\\int_0^{\\infty} \\frac{1}{1+x^n}dx$ It is quite easy to show that (by using residue theorem) $$\\int_0^{\\infty} \\frac{1}{1+x^n}dx = \\frac{2 \\pi i^{1+2/n}}{n(e^{2 \\pi i / n} - 1)} $$ for $$n \\ge 2$$ Is there any possibility to simplify $$\\frac{2 \\pi i^{1+2/n}}{n(e^{2 \\pi i / n} - 1)}$$ or it is best result? Thanks in advance!", "How do I move Steam games to a new computer without re-downloading them? I have just bought a new computer and I have everything migrated over except for my Steam games. I looked in Program Files/Steam/ and I found a folder full of the games I have downloaded, but I do not know if it is safe to just copy these folders from one computer to another (seeing as a lot of other applications will not work if you do this), or is there another recommended way? I don't really feel like re-downloading all my games. I don't have the time nor bandwidth to download 20GB over a 1.5mbps connection. Is it possible to contact Valve and get a disk with the games on it?", "When your 10-year old boy says “It’s meta,” what does it mean? In what situation and of what sort of object they use this phrase? I asked about a few days ago, quoting Maureen Dowd’s review of the movie, “J. Edgar” in New York Times. I received six answers. But I still don’t get a clear idea of what “It’s meta” means because I don't understand (or have a total inability to comprehend) the concept of “self-referential.” An answerer : “Meta in this fairly recent, casual context is supposed to mean self-referential, or recursive in some way. This is the sense in which my teenagers would use this term.” So let me resubmit the question on “meta” in simpler format. When your teenager boy says “It’s (or this is) meta,” what does it mean? In what situation and of what sort of object they use this phrase? I’m sorry for many users who lent me kind answers to my previous question. But I would like to get it fully on the meaning and usage of “it’s meta,” as a colloquial expression, not the meaning of meta as a prefix.", "How to Create a Vinyl Plastic Toy Shader? How can I make one of the vinyl toy plastic material like this? Video:", "a) Give a combinatorial proof that for every $n \\geq r \\geq 1$ that: $$\\sum_{i = 0}^{n} \\binom{i}{r - 1} = \\binom{n + 1}{r}$$ And use (a) to concoct a formula for $1^2 + 2^2 + ... + n^2$", "Connect MacBook Pro to two external monitors Is there a way to connect my MacBook Pro to two external monitors (either VGA or HDMI; no Thunderbolt) in such a way that the Mac screen serves as a third monitor? What hardware do I need?", "How to show that $\\lim \\frac{1}{n} \\sum_{i=1}^n \\frac{1}{i}=0 $? Show that $$\\lim \\frac{1}{n} \\sum_{i=1}^n \\frac{1}{i} =0 $$ I've proved that this sequence converges (it is bounded and decreasing). NOW, I need to find a sequence that is bigger than this one and goes to zero. Maybe something using geometric serie of 1/2 Thanks in advance!", "How to get the current user in ASP.NET MVC", "I'm embarking on a new web map project that seeks to display simple geometries (lines, points, polygons) and rasters/basemaps. Ideally, the map will also allow authorized users to add/remove/edit geometries and their attributes. What are the available options for the storage of data (e.g. SQL Server Spatial)? What are the available options for the presentation of data (e.g. ArcGIS Server)? I'm new to web mapping and am attempting to build a solid understanding of the available options and their pros/cons.", "When exactly does combat start and surprise take effect? So say I'm going to ambush an orc. I successfully sneak up on him and I attack. The DM determines that the orc is surprised. The orc happens to get an initiative roll of 19, while I get a 10. How would this work? I can only think of two reasonable resolutions to this. The orc, having a higher initiative, goes first. Since he's surprised, he does nothing. Then it's my turn. If the orc survives my attack, it is now his turn, and being that the orc has already gone through his round of surprise, he can now attack me or whatever, and combat proceeds as normal. I, having started the combat, go first. If the orc survives my attack, but he is surprised, so he does nothing. It is now my turn again, I attack again. If the orc survives my second attack, it is now his turn, and being that the orc has already gone through his round of surprise, he can now attack me or whatever, and combat proceeds as normal. Which one of these is correct? neither? Does starting combat secure me a turn/action at the start of initiative order like in option 2? If option 1 is correct, could I ready an action to shoot the orc, effectively granting me a similar first attack as in option 2? Sorry if this makes no sense.", "Why is FIFA against adding instant replay to the game? Is there any evidence or reason why FIFA is so against adding instant replay to soccer? I find myself seeing many unlucky or just plain wrong decisions made by refs that could be corrected with instant replay.", "Verify mysqldump backup is corruption free" ]

[ "Which is correct, \"you and I\" or \"you and me\"? When the phrase is used as an object, why so many native speakers are saying \"you and I\" instead of \"you and me\"? I'm not a native speaker but I thought \"you and me\" is correct. Not sure if this falls into the same category, but \"Just between you and me\" sounds more natural than \"Just between you and I\".", "How do I copy a property from an active object to selected objects?", "I go to the Minecraft menu and click on singleplayer to test out the 1.9 update. I made a new world (no mods), it said downloading terrain and then it crashes every time (I've tried about 20 times now). Has anyone else experienced similar issues and know what the fix may be? Here is the launcher log: Completely ignored arguments: [--nativeLauncherVersion, 301] [00:35:12] [Client thread/INFO]: Setting user: Teddy_Cromwell [00:35:12] [Client thread/INFO]: (Session ID is &lt;censored&gt;) [00:35:14] [Client thread/INFO]: LWJGL Version: 2.9.4 [00:35:14] [Client thread/WARN]: Removed selected resource pack resources (no region and battle music).zip because it's no longer compatible [00:35:14] [Client thread/INFO]: Reloading ResourceManager: Default [00:35:15] [Sound Library Loader/INFO]: Starting up SoundSystem... [00:35:16] [Thread-5/INFO]: Initializing LWJGL OpenAL [00:35:16] [Thread-5/INFO]: (The LWJGL binding of OpenAL. For more information, see http://www.lwjgl.org) [00:35:16] [Thread-5/INFO]: OpenAL initialized. [00:35:16] [Sound Library Loader/INFO]: Sound engine started [00:35:18] [Client thread/INFO]: Created: 1024x512 textures-atlas [00:35:26] [Server thread/INFO]: Starting integrated minecraft server version 1.9 [00:35:26] [Server thread/INFO]: Generating keypair [00:35:27] [Server thread/INFO]: Preparing start region for level 0 [00:35:28] [Server thread/INFO]: Preparing spawn area: 5% [00:35:29] [Server thread/INFO]: Preparing spawn area: 8% [00:35:30] [Server thread/INFO]: Preparing spawn area: 15% [00:35:31] [Server thread/INFO]: Preparing spawn area: 21% [00:35:32] [Server thread/INFO]: Preparing spawn area: 27% [00:35:33] [Server thread/INFO]: Preparing spawn area: 34% [00:35:34] [Server thread/INFO]: Preparing spawn area: 42% [00:35:35] [Server thread/INFO]: Preparing spawn area: 48% [00:35:36] [Server thread/INFO]: Preparing spawn area: 56% [00:35:37] [Server thread/INFO]: Preparing spawn area: 66% [00:35:38] [Server thread/INFO]: Preparing spawn area: 74% [00:35:39] [Server thread/INFO]: Preparing spawn area: 81% [00:35:40] [Server thread/INFO]: Preparing spawn area: 91% [00:35:41] [Server thread/INFO]: Preparing spawn area: 98% [00:35:42] [Server thread/INFO]: Teddy_Cromwell[local:E:6d7525a7] logged in with entity id 301 at (244.5, 69.0, 244.5) [00:35:42] [Server thread/INFO]: Teddy_Cromwell joined the game # # A fatal error has been detected by the Java Runtime Environment: # # EXCEPTION_ACCESS_VIOLATION (0xc0000005) at pc=0x00007fffcf6e6b37, pid=15456, tid=12424 # # JRE version: Java(TM) SE Runtime Environment (8.0_25-b18) (build 1.8.0_25-b18) # Java VM: Java HotSpot(TM) 64-Bit Server VM (25.25-b02 mixed mode windows-amd64 compressed oops) # Problematic frame: # C [ig8icd64.dll+0x16b37] # # Failed to write core dump. Minidumps are not enabled by default on client versions of Windows # # An error report file with more information is saved as: # C:\\Users\\Connor\\AppData\\Roaming\\.minecraft\\hs_err_pid15456.log # # If you would like to submit a bug report, please visit: # http://bugreport.sun.com/bugreport/crash.jsp # The crash happened outside the Java Virtual Machine in native code. # See problematic frame for where to report the bug. # AL lib: (EE) alc_cleanup: 1 device not closed Java HotSpot(TM) 64-Bit Server VM warning: Using incremental CMS is deprecated and will likely be removed in a future release", "If you are root, and you issue rm -rf / Then how far can the command go? Can you recover data from this kind of an action? Even after the binaries are gone, would the running processes still be active? What would it take to make the same physical machine boot again? What files would you need to restore to make this happen? I could try this on a VM and see, but I want to know the rationale behind what to expect if I do this.", "nomencl package : sort by order of appearance In the nomencl package, how can I make the symbols print by order of appearance in the LaTeX code?", "Piping STDERR vs. STDOUT According to \"\" (pg. 44), you can pipe only STDERR using the |&amp; redirection symbols. I've written a pretty simple script to test this: #!/bin/bash echo \"Normal Text.\" echo \"Error Text.\" &gt;&amp;2 I run this script like this: ./script.sh |&amp; sed 's:^:\\t:' Presumably, only the lines printed to STDERR will be indented. However, it doesn't actually work like this, as I see: Normal Text. Error Text. What am I doing wrong here?", "It is a win7 ultimate x64 machine. The machine was in a domain where it got those group policy settings. Now it has left the domain but it still receives the settings from the group policy. For example, the power options. I set a certain power option but soon it will be reset to another power option which is endorsed by the domain. Is there a way to remove the settings?", "Does double negation distribute over implication intuitionistically?", "REST API composite query: How do I use the result of a query subrequest in the referenceId of another subrequest? I am using Salesforce's REST API to (1) retrieve a list of object IDs according to a query, then (2) retrieve the records that correlate to those IDs. I am familiar with the Salesforce composite documentation . My request looks like this: POST: /services/data/v48.0/composite { \"allOrNone\":false, \"compositeRequest\": [ { \"method\":\"GET\", \"url\": \"/services/data/v48.0/query?q=SELECT+Id+FROM+My_Entity+WHERE+(CreatedById+!=+'asdfghjkl')\", \"referenceId\": \"myEntity\" },{ \"method\":\"GET\", \"url\": \"/services/data/v48.0/composite/sobjects/My_Entity?ids=@{myEntity.records[0].Id}\", \"referenceId\":\"myObject\" }] } My response: { \"compositeResponse\" : [ { \"body\" : { \"totalSize\" : 21, \"done\" : true, \"records\" : [ { \"attributes\" : { \"type\" : \"My_Entity\", \"url\" : \"/services/data/v48.0/sobjects/My_Entity/a0D6g000xxxxxxx\" }, \"Id\" : \"a0D6g000xxxxxxx\" }, {*record2*}, {*etc*} ]}, \"httpHeaders\" : { }, \"httpStatusCode\" : 200, \"referenceId\" : \"myEntity\" }, { \"body\" : [ { \"errorCode\" : \"PROCESSING_HALTED\", \"message\" : \"'myEntity.records' references an invalid Datatype. Only Strings and primitive data types are allowed to be referenced from previous operations.\" } ], \"httpHeaders\" : { }, \"httpStatusCode\" : 400, \"referenceId\" : \"myObject\" } ] } The first subrequest (the query) executes without errors. My problem is the second subrequest. I understand from that I can refer to the ID of a single item (e.g. myEntity.records[0].Id). Question: How do I use all items from myEntity.records in the second subrequest?", "So this is what I'm trying to do in Drupal 6: Node type A is video, node type B is a person Nodetype A has a reference field where you can enter a reference to any Node from nodetype B how can I create a block view which will be displayed on nodes from node type b, which will show all the nodes from node type A where the current node from node type B is referenced?", "I am trying the fallowing exercise : Solve $P(X^2 -2)=P(X)^2 -2$ with P a monic polynomial (non-constant) My attempt : Let P satisfying $P(X^2-2) = (P(X))^2-2$ Then $Q(X)=P(X^2-2) = (P(X))^2-2$ Therefore, $$Q(X^2-2) = (P(X^2-2))^2-2 = (P(X)^2-2)^2-2 = Q^2-2$$ As X is a solution, by defining the sequence: $(P_n)_{n \\geq 1}$ with $P_1 = X$ and for all $n \\geq 1, P_{n+1} = P_n^2-2$ We obtain a sequence of polynomials which are solutions. But I don't know how to prove it's the only one. If someone have an idea to prove it or an another method to solve the problem ? Thank you in advance for your time.", "My wife wants a 4th baby, but I don't. We have been talking about it for the last few days (talking strongly). I have raised points such as: We will get less time to spend with our current kids. The age gap between the first and the last will be too wide. It will cost more money. She will be out of work longer. We will need a bigger house. And we don't even have our own house yet (we are still renting). We will have to start again. Sleepless nights, nappies, feeding, new cot, car seat, etc etc. She says: She feels like she is missing something. She has always wanted a large family. Things will be the same regardless of having 3, or 4 kids. She agrees that money will be tighter, but wants to push through it. Our current kids are 9 months, 2 years, and 4 years. We are young married couple (25), and I have a fairly decent job. What would be the pros and cons of having another child? How can we rationally talk to the other about having/or not having another child? And what should we do if we cannot agree?", "Linear transformation of a binomial random variable? Let $X$ be a binomial random variable with parameters $n$ and $p$. Next, let: $$ Y = aX + b $$ I know that: $$ \\mathbb{E}[Y] = \\mathbb{E}[aX+b] = a\\mathbb{E}[X] + b = anp + b \\\\ \\text{Var}(Y) = \\text{Var}(aX+b) = a^2 \\text{Var}(X) = a^2np(1-p) $$ But how is $Y$ distributed?", "It has been discussed before, but in light of some of the , I can't help but wonder what is accomplished by displaying the author of a given question or answer. There is a , but if anything, I don't think it goes far enough. If questions and answers are supposed to stand on their own merit, why do we need to show the author at all? I'm not proposing any change to the way rep works; rep should still be accrued and abilities gained. The only difference is that questions and answers would appear anonymous. Does this better reflect the goals of SO? If so, how far do you think the anonymity should be taken? If not, what shortcomings am I missing?", "Why does $1+2+3+\\cdots = -\\frac{1}{12}$? $\\displaystyle\\sum_{n=1}^\\infty \\frac{1}{n^s}$ only converges to $\\zeta(s)$ if $\\text{Re}(s) &gt; 1$. Why should analytically continuing to $\\zeta(-1)$ give the right answer?", "How to split strings into text and number?", "Show that a matrix $A$ is singular if and only if $0$ is an eigenvalue. I can't find the missing link between singularity and zero eigenvalues as is stated in the following proposition: A matrix $A$ is singular if and only if $0$ is an eigenvalue. Could anyone shed some light?", "Custom Edit control inside a ExtJS Editor grid", "Travelling on Business visa to UK for tourism purposes I already have a 6 month valid UK business visa received prior to April 24 2015. I was supposed to travel to the UK in April, but my trip was cancelled on medical grounds. I am now planning to visit the UK in July for tourism. Would it be fine for me to do so? Will I be allowed to enter the UK? Should I carry the original invite letter and medical certificate to prove why I didn't go the first time?", "How do I have a camera follow my object in Unity? I have an object that automatically moves by itself and I want the main camera to automatically follow it.(Like in games such as geometry dash and jetpack joyride) This is the code for the automatic moving object in case it is needed: using UnityEngine; using System.Collections; public class automove : MonoBehaviour { public static int movespeed = 5; public Vector3 userDirection = Vector3.right; public void Update() { transform.Translate(userDirection * movespeed * Time.deltaTime); } } So does anyone know any good scripts I could add to the main camera to follow this object that automatically moves? Thanks in advance!" ]

[ "Etiquette on sending a thank you e-mail to respondents who gave me helpful information", "I was rewatching the Breaking Bad episode S04E08 (Hermanos) and I didn't quite understand why exactly Don Eladio killed Gus's partner, but he let Gus live. He says: The only reason you're alive and he's not, is because I know who you are. But I still have yet to fully understand.", "I'm trying to prove commutativity of addition for vector spaces, using the axioms for vector spaces. Apparently commutativity can be proven! Im having trouble getting a good feel for what is allowed and what is not. Here's my work so far: $u+v+u+v = 2(u+v) = 2u + 2v = u+u+v+v = u+(u+v)+v$ Here I just wanna claim that $u+(v+u)+v = u+(u+v)+v$ $\\Rightarrow -u+u+(v+u)+v+(-v) = -u+u+(u+v)+v+(-v)$ : here im just adding -u to the right, and -v to the left. Question: is this \"adding to both sides\" really legit in this context? Why? Quick help proof: $-v+v = (-1)v+(1)v = (-1+1)v = 0v = 0 = v-v$ And another: $ 0+v = v+(-v) + v = (1)v + (-1)v + v = (1-1)v + v = v = v+0$ We have $0 + (u+v) + 0 = 0+(v+u)+0 \\Rightarrow u+v = v+u$ This feels ugly and not at all elegant, especially the great leap \"add -u to both sides\" feels completely out of place. Do I need more lemmas? Is there a more elegant way? //not homework or anything, just for my own pleasure, feel free to provide theory, as it is more insightful than solutions. :) Thanks! EDIT: corrected notation a little.", "Same e-mail user, different address? I was wondering why using foo.bar@gmail.com works but not foo.bar@outlook.com. In Gmail, foo.bar@gmail.com and foobar@gmail.com (and any combination of periods in the username) is equivalent. Is this a hidden feature in Gmail?", "How do I change extension of multiple files recursively from the command line?", "I just designed this MPPT solar charge controller which outputs 4.2 V regulated via MPPT, it uses the SPV1040 IC. This will be used on a satellite with 4 side panels, each with 8 solar cells in parallel outputting 2.6 V at approximately 122 Ma. Each panel will have this exact circuit and all the outputs will be connected in parallel to a 3.7 V lithium ion camera battery. When active only 1 solar panel will be active and the other MPPT circuits will be offline or providing a very low amount of current. How should I connect the 4.2v to the battery, just directly or using some sort of controller to stop charging at 4.2v? Keep in mind the battery will always have a load and it will charge for around 50m in a 90m cycle due to being eclipsed. I would obviously like the battery to last as long as possible so I am not sure what are the implications of constantly having a battery connected to 4.2 V during 50m. Thanks. The schematic was made based off a simulation made using the ST Edesignsuite directly from the provider. Excuse my previous question about this, wasn't properly worded.", "I want to find the interval of convergence of $$\\sum_{n=0}^\\infty (\\frac{n}{n+1})^{n^2}(2x)^n$$ By the root test, $\\sqrt[n]{|(\\frac{n}{n+1})^{n^2}(2x)^n|}=|(\\frac{n}{n+1})^{n}(2x)|$ And $(\\frac{n}{n+1})^n=(1-\\frac{1}{n+1})^n\\to\\frac1e$ as $n\\to\\infty$ So I've got an open interval(of convergence) s.t. $|\\frac1e 2x|&lt;1\\implies |x|&lt;\\frac e2$. Now I need to figure out whether the series is convergent or not at the end points, $x=\\frac e2, -\\frac e2$. So there are two series I need to deal with, namely, $\\sum_{n=0}^\\infty (\\frac{n}{n+1})^{n^2}e^n$ and $\\sum_{n=0}^\\infty (\\frac{n}{n+1})^{n^2}(-1)^ne^n$. Suppose $(\\frac{n}{n+1})^{n^2}$ is increasing. Then $$(\\frac{n}{n+1})^{n^2}&lt;(\\frac{n+1}{n+2})^{(n+1)^2}\\iff 1&lt;(\\frac{n+1}{n+2})^{(n+1)^2}(\\frac{n+1}{n})^{n^2}$$ $$\\iff 1&lt;(1-\\frac{1}{n+2})^{2n+1}(1+\\frac{1}{n^2+2n})^{n^2}$$ But $(1-\\frac{1}{n+2})^{2n+1}\\to\\frac{1}{e^2}$ and $(1+\\frac{1}{n^2+2n})^{n^2}&lt;(1+\\frac{1}{n^2})^{n^2}\\to e$ So I have $1&lt;\\frac1e&lt;1$, which is a contradiction. Hence $(\\frac{n}{n+1})^{n^2}$ is not increasing. But I don't know if it's decreasing. (is it true that $(1+\\frac{1}{n^2+2n})^{n^2}\\to e$?) If $(1+\\frac{1}{n^2+2n})^{n^2}\\to e$ is true, then $(\\frac{n}{n+1})^{n^2}e^n$ converges to some positive number, so $\\sum(\\frac{n}{n+1})^{n^2}e^n$ diverges. But I don't know if it's decreasing: can't apply the alternating series convergence test(Leibniz's criterion). So, can you help me with the two end points?", "Show that $n$ lines separate the plane into $\\frac{n^2+n+2}{2}$ regions", "Referencing bib files with spaces in the filename", "We know that the maximum level a dweller can train to on any SPECIAL skill is 10, however this does not consider bonuses given from their outfit. Is there any additional benefit for going over 10? For example, a dweller with an Intelligence skill of 10 wearing a lab coat that boosts Intelligence by 3? If it is a hard cap, would it be more useful to use outfits that raise a secondary characteristic instead?", "From injective map to continuous map", "Changing content of footline in beamer", "I think my son was trying to guess the passcode! What do I do? I can't wait 42 years!", "Prove that inequality is true for $x>0$: $(e^x-1)\\ln(1+x) > x^2$", "Nothing shows up in the terminal when I type my password", "Removing intercept from GLM for multiple factorial predictors only works for first factor in model I am running a binomial logistic regression with a logit link function in R. My response is factorial [0/1] and I have two multilevel factorial predictors - let's call them $a$ and $b$ where $a$ has 4 factor levels $(a_1,a_2,a_3,a_4)$ and $b$ has 9 factor levels $(b_1,b_2,\\dotsc,b_9)$. Therefore: mod &lt;- glm(y ~ a + b, family = binomial(logit), data=pretend) summary(mod) The model output would then show all the information about the model as well as the coefficients. There is a factor level for both a and b missing (a1 and b1) from the summary output. I understand that it is constrained in the \"intercept\" of the model. I have read that if I want to remove the intercept term and see the estimates for those factor levels I can just add -1 to the model formula, i.e.: mod2 &lt;- glm(y ~ a + b - 1, family=binomial(logit), data=pretend) summary(mod2) In the new model (mod2) the intercept term is then gone and variable a's factor-level a1 is given amongst the list of coefficients. But, variable b's factor-level b1 is still missing and given that there is no intercept term anymore, how can I interpret the odds-ratio for that factor level then? Could someone please explain to me how to get the coefficient for b1 too and why this is happening?", "Proof that total derivative is the only function that can be added to Lagrangian without changing the EOM So I was reading this: and while the answers for the first question are good, nobody gave much attention to the second one. In fact, people only said that it can be proved without giving any proof or any. So, if I have a Lagrangian and ADD an arbitrary function of $\\dot{q}$, $q$ and $t$ in such a way that the equations of motion are the same, does this extra function MUST be a total time derivative? EDIT Ok, I changed my question a little bit: Question: If I have a function that obeys the Euler-Lagrange equation off-shell, this implies that my function is a time derivative? (This was used in Qmechanic's answer of this other question: , equation 14.) Also, why people only talk about things that change the Lagrangian only by a total derivative? If this is not always the case that keeps the equation of motion the same, so why is it so important? And why in the two questions I posted about the same statement on Landau&amp;Lifshitz's mechanics book only consider this kind of change in the Lagrangian?", "In \"Seeing like a state\" of James C.Scott there is a sentence at the beginning of a paragraph (Acknowledgements xi): There are a good many scholars whose writings opened up new perspectives for me or provided outstanding analyses of issues that I could not have hoped to study so comprehensively on my own. What worries me is a good many scholars. Is this some type of inversion or ancient English? Is this grammatically right? Why is a here? I thought that appropriate version would be There are many good scholars. Am I wrong?", "QGIS 3.0 and Qt 5.7 time schedule When will QGIS 3.0 with QT5.7 (possibly) be released as a stable and long term support version?", "I have an elliptic curve $E$ over $\\mathbb{F}_{11}$ defined by $y^2=x^3+4x$ with the point at infinity $\\mathcal{O}$ I have a divisor of $E$, defined by $$D=\\left[(0,0)\\right]+\\left[(2,4)\\right]+\\left[(4,5)\\right]+\\left[(6,3)\\right]-4\\left[\\mathcal{O}\\right]$$ I know that $\\text{deg}(D)=1+1+1+1-4=0$ and it is clear that $\\text{sum}(D)=\\infty$ Therefore $D$ is the divisor of a function - we want to find this function I am given \\begin{align}\\text{div}(y-2x)&amp;=\\left[(0,0)\\right]+2\\left[(2,4)\\right]-3\\left[\\mathcal{O}\\right]\\\\ \\text{div}(x-2)&amp;=\\left[(2,4)\\right]+\\left[(2,-4)\\right]-2\\left[\\mathcal{O}\\right] \\end{align} I am then told that we can express $D$ as follows: $$D = \\left[(2,4)\\right]+\\text{div}\\left(\\frac{y-2x}{x-2}\\right)+\\left[(4,5)\\right]+\\left[(6,3)\\right]-3\\left[\\mathcal{O}\\right]$$ However, when I expand this back out, I get the following: \\begin{align}D &amp;= \\left[(2,4)\\right]+\\text{div}\\left(\\frac{y-2x}{x-2}\\right)+\\left[(4,5)\\right]+\\left[(6,3)\\right]-3\\left[\\mathcal{O}\\right]\\\\ &amp;= \\left[(2,4)\\right]+\\text{div}(y-2x)-\\text{div}(x-2)+\\left[\\left(4,5\\right)\\right]+\\left[(6,3)\\right]-3\\left[\\mathcal{O}\\right]\\\\ &amp;= \\left[(2,4)\\right]+\\left(\\left[(0,0)\\right]+2\\left[(2,4)\\right]-3\\left[\\mathcal{O}\\right]\\right)-\\left(\\left[(2,4)\\right]+\\left[(2,-4)\\right]-2\\left[\\mathcal{O}\\right]\\right)+\\left[\\left(4,5\\right)\\right]+\\left[(6,3)\\right]-3\\left[\\mathcal{O}\\right]\\\\ &amp;= \\left[(0,0)\\right]+2\\left[(2,4)\\right]+\\left[(4,5)\\right]+\\left[(6,3)\\right]+2\\left[\\mathcal{O}\\right]-\\left[(2,-4)\\right] \\end{align} which clearly isn't equivalent to the original $D$ unless $$\\left[(2,4)\\right]+2\\left[\\mathcal{O}\\right]-\\left[(2,-4)\\right]=-4\\left[\\mathcal{O}\\right]$$ Can anyone either explain what I've done wrong or show me how I can obtain the above equation please This question comes in three parts: Step 1 - This one Step 2 - Step 3 -" ]

[ "On every bootup it's the same: /dev/sda1: clean, 908443/38690816 files, 44176803/154733312 blocks Is it some kind of option Ubuntu uses to ensure filesystem consistency or is there something wrong with my HDD? fsck takes up to 30s while booting and so about triples the time needed otherwise. Full output (partly in German): Begin: Loading essential drivers ... done. Begin: Running /scripts/init-premount ... done. Begin: Mounting root file system ... Begin: Running /scripts/local-top ... done. Begin: Running /scripts/local-premount ... done. Begin: Running /scripts/local-bottom ... done. done. Begin: Running /scripts/init-bottom ... done. fsck von util-linux 2.20.1 /dev/sda1: sauber, 908443/38690816 Dateien, 44176803/154733312 Blöcke udevd[623]: unknown key 'SYSFS{idVendor}' in /lib/udev/rules.d/45-libticables.rules:6 udevd[623]: invalid rule '/lib/udev/rules.d/45-libticables.rules:6' * Starting mDNS/DNS-SD daemon [ OK ] * Starting Reload cups, upon starting avahi-daemon to make sure remote queues are populated [ OK ] * Starting configure network device security [ OK ] * Starting bluetooth daemon [ OK ] ####* Starting all other stuff", "Show that Function Compositions Are Associative", "A non-trivial, non-negative, function bounded below by its derivative with $f(0)=0$? I did not know what to search to see if this existed elsewhere. But, I could not find it. Here's the question: Does there exist a continuously differentiable function, $f: [0,1] \\rightarrow [0, \\infty)$, such that the following hold? (i) $f(0) = 0$ (ii) $f'(x) \\le c f(x)$ for all $x$ ($c$ is a fixed constant) (iii) $f \\not\\equiv 0$ This was a fun problem someone asked me a long time ago. I have always been convinced there is no such function, but I cannot prove it. I have mainly tried using the mean value theorem (in multiple forms), and re-wording the problem in terms of the integral of a continuous function to no avail. I spent some time trying to use (ii), the definition of derivative, and squeeze theorem, but no luck. After much time trying to prove non-existence, I spent a little time trying to find such a function... also with no luck. This problems ability to avoid being solved has since taken away the original fun and replaced it with a twinge of annoyance.", "is there a quick way to sort the items of a select element? Or I have to resort to writing javascript? Please any ideas. &lt;select size=\"4\" name=\"lstALL\" multiple=\"multiple\" id=\"lstALL\" tabindex=\"12\" style=\"font-size:XX-Small;height:95%;width:100%;\"&gt; &lt;option value=\"0\"&gt; XXX&lt;/option&gt; &lt;option value=\"1203\"&gt;ABC&lt;/option&gt; &lt;option value=\"1013\"&gt;MMM&lt;/option&gt; &lt;/select&gt;", "hyperlink name with biblatex authoryear (biblatex 1.4b)", "I was writing some Unit tests last week for a piece of code that generated some SQL statements. I was trying to figure out a regex to match SELECT, INSERT and UPDATE syntax so I could verify that my methods were generating valid SQL, and after 3-4 hours of searching and messing around with various regex editors I gave up. I managed to get partial matches but because a section in quotes can contain any characters it quickly expands to match the whole statement. Any help would be appreciated, I'm not very good with regular expressions but I'd like to learn more about them. By the way it's C# RegEx that I'm after. Clarification I don't want to need access to a database as this is part of a Unit test and I don't wan't to have to maintain a database to test my code. which may live longer than the project.", "What fallacy dismisses problems by presenting \"bigger\" problems? Wasn't really sure how to phrase this, but I'm thinking of an instance in which someone diminishes a problem by presenting one of larger scope - as a rather shoddy example, \"x political problem in America doesn't matter because half the world's population is starving.\" I honestly have no idea if this is considered fallacious or not, but for some odd reason I can't shake the feeling that someone has described it to me as a fallacy before. Am I crazy or is there something to this (or something similar)?", "Reason for the current trend to use «she» as the gender-neutral pronoun?", "How to describe a guy who is popular with girls? Perhaps I should make it clear: - He naturally attracts girls. - He doesn't chase girls and have no intention for any relationship. - You just see him often together with girls.", "In Mootools, I'd just run if ($('target')) { ... }. Does if ($('#target')) { ... } in jQuery work the same way?", "I run into this infinite product today. I don't have that much experience evaluating products therefore I don't have any idea of how to tackle this. Here is the question. Evaluate (if possible) in a closed form the product: $$\\Pi = \\prod_{n=1}^{\\infty} \\frac{1}{1+\\pi^{{\\large \\frac{1}{2^n}}}}$$ The numerical value seems to be $\\Pi= 0.534523$ which is very close to $\\frac{\\pi}{6}$ taking into account that $\\frac{\\pi}{6} \\approx 0.523598$. In the mean time W|A evaluates it to $0$. I'm lost. Can the community help? Edit: Based on the answer we have two products. The product I asked tends to zero and the bonus product provided by @you're in my eye (thanks for that) is $\\frac{\\ln \\pi}{\\pi-1}$. Thanks for the quick response.", "I heard Andrew Ng (in a video I unfortunately can't find anymore) talk about how the understanding of local minima in deep learning problems has changed in the sense that they are now regarded as less problematic because in high-dimensional spaces (encountered in deep learning) critical points are more likely to be saddle points or plateaus rather than local minima. I've seen papers (e.g. ) that discuss assumptions under which \"every local minimum is a global minimum\". These assumptions are all rather technical, but from what I understand they tend to impose a structure on the neural network that make it somewhat linear. Is it a valid claim that, in deep learning (incl. nonlinear architectures), plateaus are more likely than local minima? And if so, is there a (possibly mathematical) intuition behind it? Is there anything particular about deep learning and saddle points?", "how to prove $G_1$ and $G_2$ aren't isomorphic?", "How can I reliably and accurately identify the passive voice in writing or speech?", "I am working on binary classification problem, I try to evaluate the performance of some classification algorithms (LR,Decission Tree , Random forest ...). I am using a cross validation technique (to avoid over-fitting) with AUC ROC as scoring function to compare the performance of the algorithms, but I am getting a weird results with Random forest and AdbBoost, I have a perfect AUC_ROC score (i.e. =1) despite the fact that the recall(TPR) and FPR of this algorithms are different from 1 and 0 respectively . def FPR(y_true, y_pred): tn, fp, fn, tp = confusion_matrix(y_true, y_pred).ravel() result = fp / (fp+tn) return result def FNR(y_true, y_pred): tn, fp, fn, tp = confusion_matrix(y_true, y_pred).ravel() result = fn / (tp+fn) return result FPR_scorer = make_scorer(FPR) FNR_scorer = make_scorer(FNR) def get_CrossValResults2(model,cv_rst,bestIndx): best=pd.DataFrame.from_dict(cv_rst).iloc[bestIndx] roc=&quot;{:.12f}&quot;.format(best['mean_test_roc_auc']) acc =&quot;{:.0%}&quot;.format(best['mean_test_accuracy']) prec =&quot;{:.0%}&quot;.format(best['mean_test_precision']) rec =&quot;{:.0%}&quot;.format( best['mean_test_recall']) f1 =&quot;{:.0%}&quot;.format(best['mean_test_f1']) r2=&quot;{:.2f}&quot;.format(best['mean_test_r2']) g_mean=&quot;{:.2f}&quot;.format(best['mean_test_gmean']) pr_auc=&quot;{:.8f}&quot;.format(best['mean_test_pr']) fnr=&quot;{:.0%}&quot;.format(best['mean_test_fnr']) fpr=&quot;{:.0%}&quot;.format(best['mean_test_fpr']) rst = pd.DataFrame([[ model, acc,prec,rec,fpr,fnr,f1,roc,pr_auc,g_mean,r2]],columns = ['Model', 'Accuracy', 'Precision', 'Recall','FPR','FNR', 'F1-Score','ROC_auc','PR_auc','gmean','r2']) return rst cross_val_rst = pd.DataFrame(columns = ['Model', 'Accuracy', 'Precision', 'Recall','FPR','FNR', 'F1-Score','ROC_auc','PR_auc','gmean','r2']) scoring = {'accuracy':'accuracy','recall':'recall','precision':'precision','fpr':FPR_scorer,'fnr':FNR_scorer,'f1':'f1' ,'roc_auc':'roc_auc','pr':'average_precision','gmean':Gmean_scorer,'r2':'r2'} param_grid = {'n_estimators': [200], 'max_depth': [80,90], 'min_samples_leaf': [2,3, 4], 'min_samples_split': [2,5,12], 'criterion': [ 'gini'], 'class_weight' : [class_weights], 'n_jobs' : [-1]} clf = GridSearchCV(RandomForestClassifier(class_weight=class_weights), param_grid, cv=kfold,scoring=scoring,refit=refit)#Fit the model bestmodel = clf.fit(X,Y) cross_val_rst = cross_val_rst.append(get_CrossValResults2(model='Random Forrest',bestIndx=bestmodel.best_index_,cv_rst=bestmodel.cv_results_),ignore_index=True)", "If we have a real valued function $f$ continuous at some point $a$, is it necessarily true that $f$ is Riemann integrable on the interval $[a - \\delta, a + \\delta]$ if a $\\delta &gt; 0$ exists?", "Where Android apps store data? Could you list all possible directories where Android apps may store data, providing description what kind of data are stored in each directory?", "Is $R^2$ useful or dangerous? I was skimming through by Cosma Shalizi (in particular, section 2.1.1 of the ), and was reminded that you can get very low $R^2$ even when you have a completely linear model. To paraphrase Shalizi's example: suppose you have a model $Y = aX + \\epsilon$, where $a$ is known. Then $\\newcommand{\\Var}{\\mathrm{Var}}\\Var[Y] = a^2 \\Var[x] + \\Var[\\epsilon]$ and the amount of explained variance is $a^2 \\Var[X]$, so $R^2 = \\frac{a^2 \\Var[x]}{a^2 \\Var[X] + \\Var[\\epsilon]}$. This goes to 0 as $\\Var[X] \\rightarrow 0$ and to 1 as $\\Var[X] \\rightarrow \\infty$. Conversely, you can get high $R^2$ even when your model is noticeably non-linear. (Anyone have a good example offhand?) So when is $R^2$ a useful statistic, and when should it be ignored?", "Did spacetime start with the Big bang? Did spacetime start with the Big Bang? I mean, was there any presence of this spacetime we are experiencing now before big bang? And could there be a presence/existence of any other space-time before the big bang?", "Prove that $\\operatorname{trace}(A) = 0$ if and only if $A^2 = 0$." ]

[ "Refused entry to UK, not sure what to do I'm a writer and theater/film director who has been traveling nearly all my life without incident. In February, I decided to pull up stakes in NYC and move to London. I am a freelancer and I'm working with three different organizations in NYC so I wasn't working illegally in the UK. I was, however, seeing if there might be some opportunities in London, ie. meeting with Artistic Directors of various theatre companies to see if they might be interested in producing my work. In April, I was invited to a conference in San Diego and then a film festival in Switzerland. I didn't think it would be a problem if I went and then bummed around in France for a few days since I hadn't broken any laws and had left the UK well under my six month leave to stay. Well, when I tried to return to London, I was denied entry at Luton. The border control officer said I didn't have enough funds for a two month stay and put a black cross over a stamp in my passport. They put me in a detention room until the next flight back to Lyon, which was the following morning. I don't know anyone in Lyon so I ended up going to a friend's place in Paris. After a few days of not knowing what to do, a friend suggested that perhaps I should try going back to London on the Eurostar since border control is in Paris. I wondered if I ought to go to the British Embassy but was deterred by something on their website that says that a visitors visa could take up to three weeks (I can't sit around here in Paris for three weeks) and anyway, the decision ultimately is with the border control, so I decided to take a chance on the Eurostar. I bought myself a return ticket in two weeks to Paris just so I had something to show. Well, the UK border control denied me entry after giving me a third degree. They accused me of lying and seeking work in the UK. They also insisted that the amount of money I had was not enough to live on for two weeks. So I'm back at my friend's place in Paris, wondering what to do. Is it possible for me to ever get back to the UK? I had to cancel one meeting and I'm wondering if I have to cancel going to the Sheffield DocFest. (Two of my projects were accepted to programs there.) Should I apply for a visa from the British Embassy? Will this really take three weeks? When I started to say something about obtaining a visa, the border control officer cut me off and said, \"Why are you going to the Embassy? This has nothing to do with the Embassy. We make the decisions.\"", "Which way is up? (electric outlet)", "Can we model gravitation as a repulsive force? This question is actually related to my earlier question (\"\"). The fact that objects move a lot in the universe and that the universe is expanding, can imply that gravity is a repulsive force that increases with distance.. so the farthest objects repel us more. This can still explain several existing observations, e.g., why does the apple fall? Motion is the result of such repulsion. Two objects unlucky enough not to be moving relative to each other get squished due to the repulsion of the rest of the universe around them. The earth repels the apple less than the stars so it is pushed towards the earth. Furthermore, it can explain the expanding universe without the need for dark energy. This could be demonstrated in a thought experiment. If we take a lot of same-charge particles (with small mass) such as electrons and lock them in a large box at a low enough temperature. The mutual repulsion of the particles may cause similar motion as if due to gravitational attraction. Another experiment would be to measure the slight changes in our weight during day and night when the sun and earth align (if their masses are large enough to detect the feeble change in repulsion). [EDIT: the question in the original form may not have been clear. It is \"can we model\".. with a yes/no answer and why (not). If downvoting, please justify.", "Android Debugging, how?", "Inspired exercise Sheet from Indesign I would like to create this sheet which was made it by adobe indesign Could someone create it with latex ? Here's my code: \\documentclass[12pt,a4paper,twocolumn]{report} \\usepackage[margin=0.5in]{geometry} \\usepackage[french]{babel} \\usepackage{fontspec} \\usepackage{graphicx} \\usepackage{amsthm,amssymb,amsfonts,mathtools} \\usepackage[utf8]{inputenc} \\usepackage{multicol} \\usepackage{multirow} \\usepackage{amssymb} \\usepackage{array} \\usepackage{graphicx} \\setlength{\\columnseprule}{0.5pt} \\thispagestyle{empty} %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% \\begin{document} %%%%%%%%%%head%%%%%%%%%%%%%%%%%%%%%%% \\twocolumn[ \\begin{@twocolumnfalse} \\begin{center} \\fbox{\\Large Exercise Sheets} \\end{center} \\hrulefill \\end{@twocolumnfalse} ] %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% \\fbox{ Exercise $1$:}\\\\ Compute the following limits \\begin{multicols}{2} \\begin{enumerate} \\item $\\lim_{x\\to 2}\\dfrac{4x^{3}-5x-22}{x^{2}-x-2}$ \\item $\\lim_{x\\to 0^{+}}\\dfrac{x-\\sqrt{x}}{x+\\sqrt{x}}$ \\item $\\lim_{x\\to 1}\\dfrac{\\sqrt{x+3}+\\sqrt{x}-3}{x-1}$ \\item $\\lim_{x\\to 2}\\dfrac{x^{2}\\sqrt{x+2}-8}{4-x^{2}}$ \\end{enumerate} \\end{multicols} %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% \\fbox{ Exercise $2$:}\\\\ Let $n\\in\\mathbb{N}^{*}$ \\begin{enumerate} \\item calculate : ${\\displaystyle \\lim_{x\\to 0}\\dfrac{1-\\cos(x)\\cos(2x)\\ldots+\\cos(nx)}{x^2} }$ \\item b \\item c \\item d \\item e \\item f \\end{enumerate} %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% \\end{document}", "Usage of \"second/third/fourth ... last\" In German there is a pattern for counting items from the end of a list. The last item is \"das letzte\", the one before is \"das vorletzte\", the one before that is \"das vorvorletzte\" and for each other item there's just another \"vor\" added. While searching for an English translation for the German word \"vorvorvorletzte\" I came across and but none of them showed any usage pattern. Furthermore I didn't find any indication of which variant (\"to\", \"from\", no preposition) is used most nor to what area of the world those translations apply. So I am still wondering: When there are items 1, 2, 3, 4 and 5, how can/will item 2 be called? third from last? fourth from last? anteantepenultimate? fourth-last? fourth to last? the last but three item? the last but four item? Is this a question of dialect/local use?", "I have downloaded tar.gz files. But I don't know how to install it. How do I install this kind of file?", "Let $E_n$ be $$E_n:=\\{f\\in C[0,1]\\mid \\text{exist } x_f\\in[0,1] \\text{ such that } |f(x)-f(x_f)|\\leq n|x-x_f|,\\, \\forall x\\in[0,1]\\}.$$ How show that $E_n$ is nowhere dense, that is, $\\mathrm{int}\\ \\overline{E_n} = \\emptyset$? Can someone help me?", "How to remove the lines which appear on file B from another file A?", "Irrationality of sum of two logarithms: $\\log_2 5 +\\log_3 5$ I try to prove that the number $$\\log_2 5 +\\log_3 5$$ is irrational. But I have no idea how to do it. Any hints are welcome.", "\"One of them was/were you\" If I am talking to somebody about a certain group of people in the third person, and then want to refer to the person I am talking with as one of those people, which do I say? One of them were you One of them was you.", "Whenever I play a PC game with the directional keys, I can only press two buttons at a time. For instance if I am playing a shooter like R-Type, I cannot hold down the fire button while moving diagonally at the same time. The computer simply ignores the extra button press. How do I remove this limit so I can shoot while moving diagonally? This limitation seems to apply for every game. I am running Windows 7 if it makes any difference. I noticed the same problem back when I used Windows XP.", "Let $f:[0,+\\infty)\\to\\Bbb R$ be a function bounded on each finite interval. I want to show that if $\\lim\\limits_{x\\to+\\infty}[f(x+1)-f(x)]= L,$ then also $\\lim\\limits_{x\\to+\\infty}\\dfrac{f(x)}x = L$", "If G is a group, prove that $(ab)^n =a^nb^n$ implies G is abelian. I need to prove the equivalence of the following two statements, if $G$ is a group: $G$ is abelian $\\Leftrightarrow$ for each $a,b$ in $G$: $(ab)^n = a^n b^n$ for each integer $n$ I have done the $\\Rightarrow$ implication, but I have no idea how to approach $\\Leftarrow$, any hints are very welcome.", "No notification was received for an edit to a post", "Special package combination gives \"No room for new \\write.\"", "How to split strings into text and number?", "Boundary conditions for calculus of variations in phase space and under canonical transformations This might be a stupid question, but I just don't get it. In Hamiltonian mechanics when examining conditions for a $(\\boldsymbol{q},\\boldsymbol{p})\\rightarrow(\\boldsymbol{Q},\\boldsymbol{P})$ transformation to be canonical one starts with $$ \\dot{q}_ip^i-H(\\boldsymbol{q},\\boldsymbol{p},t)= \\dot{Q}_iP^i-\\bar{H}(\\boldsymbol{Q},\\boldsymbol{P},t)+\\frac{d}{dt}W(\\boldsymbol{q},\\boldsymbol{Q},t)$$ where $\\bar{H}$ is the transformed Hamiltonian, and $W$ is the generating function (now a function of $\\boldsymbol{q}$ and $\\boldsymbol{Q}$). This term shouldn't break Hamilton's principle, since $$ \\delta\\int_{t_1}^{t_2} dt\\frac{d}{dt}W(\\boldsymbol{q},\\boldsymbol{Q},t)=\\delta W(\\boldsymbol{q},\\boldsymbol{Q},t)|_{t_2}-\\delta W(\\boldsymbol{q},\\boldsymbol{Q},t)|_{t_1}=0-0=0 .$$ But I don't see why the variation of $W$ should disappear at the endpoints (say at $t_1$). Expanding leads to: $$ \\delta W(\\boldsymbol{q},\\boldsymbol{Q},t)|_{t_1}=\\left(\\frac{\\partial W}{\\partial q_i}\\right)_{t_1}\\underbrace{\\delta q_i(t_1)}_{=0}+ \\left(\\frac{\\partial W}{\\partial Q_i}\\right)_{t_1}\\delta Q_i(t_1)=\\left(\\frac{\\partial W}{\\partial Q_i}\\right)_{t_1}\\delta Q_i(t_1).$$ $\\boldsymbol{Q}$ is itself a function of $\\boldsymbol{q}$ and $\\boldsymbol{p}$, so $$ \\delta Q_i(t_1)=\\left(\\frac{\\partial Q_i}{\\partial q_k}\\right)_{t_1}\\underbrace{\\delta q_k(t_1)}_{=0}+\\left(\\frac{\\partial Q_i}{\\partial p_k}\\right)_{t_1}\\delta p_k(t_1)=\\left(\\frac{\\partial Q_i}{\\partial p_k}\\right)_{t_1}\\delta p_k(t_1). $$ It seems as if we also needed the variation of $\\boldsymbol{p}$ to vanish at the endpoints, and I don't get this because (at least in cartesian coordinates) $\\boldsymbol{p}=m\\dot{\\boldsymbol{q}}$ and the velocity can be different along the original and the varied orbitals even at the endpoints (they can point in totally different directions), so in general $\\delta \\dot{\\boldsymbol{q}}(t_1)\\neq 0$. What am I doing wrong? Can someone help me with this, please?", "Does the full quarantine period have to be observed for short trips of less than 14 days to England? I am planning to go to England for 2 days in preparation of moving (I already have a place rented and would be staying there) a few weeks later. I am coming from a country where I would need to do a 14 day quarantine as soon as I enter England. Does this mean that I have to stay in England for 14 days or can I leave the country before the end of the 14 day quarantine without facing a penatly? I have found no information about what the rules are for planned stays of less than 14 days on the , while seems to say that short trips are OK. Official sources would be appreciated.", "Does the fact that matrices $A, B$ are similar imply that $A+cI$ is similar to $B+cI$? Let $A, B$ be similar $n \\times n$ matrices over (say) $\\mathbb{R}.$ Is it the case that $A+cI$ is similar to $B+cI$? Here is an argument (which seems too good to be true...) Since $A, B$ are similar, they have the same Jordan form. So we can write $PAP^{-1}=QBQ^{-1}=J$ for $P, Q$ invertible matrices. Hence we have $P(A+cI)P^{-1}=PAP^{-1}+cI= J+cI.$ Similarly, we find $Q(B+cI)Q^{-1}=J+cI.$ Hence $A+cI$ and $B+cI$ are both similar to $J+cI$ and hence similar to each other. Is this correct?" ]

[ "I want to know if this is grammatically correct \" How long would the conference be for?\".", "How do you reset timers?", "How can I ensure my exit from the US by land is recorded? Seeing as the US does not perform border control on exit (save for occasional spot checks, usually when traffic is moving slowly at the border), how do I make sure my exit by land is recorded so that I'm not incorrectly flagged as an overstayer? When exiting the US by air or sea, this is not a problem, as airlines and shipping companies send passenger records to US authorities. What about exiting by land though?", "How can I detect if my apple device supports Bluetooth Low Energy", "I read in the book Applied Analysis by Hunter and Nachtergale that the sequence $x(n)=\\log(n)$ is not Cauchy since $\\log(n)\\to\\infty$ But that seems to be irrelevant to the definition of a Cauchy sequence which I understand is as follows: A sequence $x(n)$ is said to be Cauchy if for every $\\epsilon &gt; 0$ there exists an $N$ such that $\\lvert x(m)-x(n)\\rvert &lt; \\epsilon$ for all $m,n&gt;N$. This sequence $(\\log n)$ seems to meet the definition. So how come it is not considered Cauchy?", "How do I prove that then $f(x) = 1$ for some $x ∈ [0, 1]$? We are asked the following: let $f(x)$ be a continuous function on $[0, 1]$ such that $$\\int _ {0} ^ {1} \\ f(y) dy = 1$$ prove that $f(x) = 1$ for some $x ∈ [0, 1]$ The question asks to take into account Rolle's Theorem and Mean Value Theorem. I'm aware of the definitions, but I am really unsure how to answer this question and my tutors are not really responding till after easter. Could someone please help? Why is there a \"y\" involved? Thanks you", "What are some grandiloquent, or simply better, ways of expressing \"an idea/thought suddenly came to me\", or \"an idea/thought struck me\", or \"I was struck by an idea/thought\"?", "How to fix pagination for custom loops? I have added a custom/secondary query to a template file/custom page template; how can I make WordPress use my custom query for pagination, instead of using the main query loop's pagination? Addendum I have modified the main loop query via . Why isn't pagination working, and how do I fix it?", "Non-static variable cannot be referenced from a static context", "Coupon Collector Problem with Batched Selections I am trying to solve a variation on the . In this scenario, someone is selecting coupons at random with replacement from n different possible coupons. However, the person is not selecting coupons one at a time, but instead, in batches. Here's an example problem formulation: There are 100 distinct coupons. A person makes selections in 10-coupon batches at random (each coupon with replacement). What is the expected number of batches necessary to have selected 80 unique coupons? I have been able to determine the expected number of selections necessary to have selected k unique coupons when selecting one at a time (much like Henry's ), but I'm a bit stumped as to how to go about solving it with this particular wrinkle. Any tips/guidance would be greatly appreciated.", "DNS subdomain (child) NS records If we have example.com we would setup things something like this: $ORIGIN example.com. @ 1D IN SOA ns1.example.com. hostmaster.example.com. ( 2002022401 ; serial 3H ; refresh 15 ; retry 1w ; expire 3h ; nxdomain ttl ) IN NS ns1.example.com. IN NS ns2.example.com. since in the parent zone .com. there is already NS record for the example.com. child zone and A glue record for the ns1.example.com. for what purpose do we state NS records again in the child zone? and also, do we need to state A record for the name servers in the child zone itself?", "Given the following HTML: &lt;div id=\"container\"&gt; &lt;!-- Other elements here --&gt; &lt;div id=\"copyright\"&gt; Copyright Foo web designs &lt;/div&gt; &lt;/div&gt; I would like #copyright to stick to the bottom of #container. Can I achieve this without using absolute positioning?", "Monos in $\\mathsf{Mon}$ are injective homomorphisms. Let $f: M \\to N$ be a mono in $\\mathsf{Mon}$. I want to prove that the underlying function $U(f): U(M) \\to U(N)$ is injective. How can this be done ? Thanks in advance.", "Allow the creation of links in formatted code through markdown or the GUI As pointed out in it is possible to create a link in formatted code. But, only by using explicit HTML. Since I think creating a link to documentation within a code block is a fairly common use case, it should be possible to do this using the GUI. I should be able to highlight some code. Press the code formatting button. Then highlight some code within that and press the link button and create a link. Today this results in: [parseInt][3](\"01\", 10); it should result in: (\"01\",10);", "Access gnome-shell messaging tray using keyboard Is there a keyboard shortcut to access the gnome-shell messaging tray? E.g. For responding to incoming IM, etc.", "Problem with the header/ footer width I have recently started using the geometry package to format the margins of my documents. Although, I've noticed that the width of the header/ footer remains the same. How can I correct this? Here's a MWE: \\documentclass{article} \\usepackage{geometry} \\usepackage{fancyhdr} \\pagestyle{fancy} \\usepackage{blindtext} \\lhead{} \\chead{Header} \\rhead{} \\lfoot{} \\cfoot{Footer} \\rfoot{\\thepage} \\renewcommand{\\headrulewidth}{1pt} \\renewcommand{\\footrulewidth}{1pt} \\begin{document} \\newgeometry{margin=0.5in, bottom=1in, top=1in} \\Blinddocument \\end{document}", "Minion Pro, TL2016 and LuaLaTeX", "Zombies - Why do they need to feed on living animals/humans?", "Causes of hexagonal shape of Saturn's jet stream NASA has just shown a more detailed picture of the hexagonal vortex/storm on Saturn: Is that theoretically understood what is the cause behind this eye-catching nontrivial, regular yet not circular, shape? If so, what is the cause? I expect some explanation in terms of \"nonlinear equations\" of \"mathematical physics\" and \"solitons\". P.S. (added a day after this question and the first answer was posted): On where I posted the same question, people came up with some articles and phrases like \"Rossby waves\" and \"resonance of latitude-dependence Coriolis frequency\".", "What are all of the connected subsets of $\\mathbb{Q}$? The answer are the singletons of $\\mathbb{Q}$. I can show that the open intervals of $\\mathbb{Q}$ are disconnected by choosing some irrational in the open set and using it to form a separation. But strangely enough, I am having a hard time seeing why the subset $\\{p,q \\}$ of $\\mathbb{Q}$ is disconnected. If say $p &lt; q$ and we choose some irrational $p &lt; x &lt;q$, the separation of $\\{p,q \\}$ would, I think, be given by $ \\{p\\}$ and $\\{q\\}$. But these aren't open in $\\mathbb{Q}$ ...?" ]

[ "Possibility of making dark energy equivalent with dark matter", "Changing top, bottom, left & right margins on the fly I’m trying to find a way of being able to modify all of the margins of a page whenever I want to and as many times as I want to on a single page in order to be able to put text very easily where I want on a page. I have thought of using the geometry package and using \\newgeometry{left=6.75cm, right=1cm, top=1cm, bottom=1cm} %… \\restoregeometry but unfortunately this only works for whole pages, so I can only change the margins once per page (and then they are valid for the whole page without having the possibility of changing them again). I found the following script on the internet which enables users to change margins on the fly, just as I want to. The code below works fine and enables me to change the left and right margins of my page as many times as I want to, but unfortunately, it doesn’t give me the option of changing the top and bottom margins. % placed before \\begin{document} \\newenvironment{changemargin}[2]{% \\begin{list}{}{% \\setlength{\\leftmargin}{#1}% \\setlength{\\rightmargin}{#2}% }% \\item[]} {\\end{list}} % And then inside the document, whenever I want to use % the command to change the margins on the current page \\begin{changemargin}{1.9875cm}{-3.7625cm} % this means the left margin increases by 1.9875cm compared % to the default left margin (4.7625cm) (so left margin=6.75cm here) % and the right margin decreases by 3.7625cm (so right margin=1cm) % ... (text or pictures in new environment) \\end{changemargin} For this reason, I tried to adapt the code above and came up with the code below: % placed before \\begin{document} \\newenvironment{changemargin}[3]{% \\begin{list}{}{% \\setlength{\\leftmargin}{#1}% \\setlength{\\rightmargin}{#2}% \\setlength{\\topmargin}{#3}% }% \\item[]} {\\end{list}} % And then to use the command: \\begin{changemargin}{1.9875cm}{-3.7625cm}{1cm} % ... \\end{changemargin} It compiles and still changes the left and right margins but the top margin remains unchanged. (I haven’t yet tried to change the bottom margin). Can anyone help me get this code to work completely, and enable me to modify the left, right, top and bottom margins of a page? Thanks.", "ii) Show that $u$ is not a real part of the function which analytic on $\\mathbb{C} \\backslash \\lbrace 0 \\rbrace$ Suppose $u(x,y)=\\ln(x^2+y^2)$ i) Show that $u$ is harmonic on $\\mathbb{C} \\backslash \\lbrace 0 \\rbrace$ ii) Show that $u$ is not the real part of a function which analytic on $\\mathbb{C} \\backslash \\lbrace 0 \\rbrace$ I manage to show the first part. For the second part, note that $u(x,y)=\\ln(x^2+y^2)=\\ln(|z|^2)=2 \\Re \\log(z)$ But this only show that $u$ is not a real part of $\\log(z)$. I don know how to show $u$ cannot be the real part of a function which analytic on $\\mathbb{C} \\backslash \\lbrace 0 \\rbrace$ Can anyone guide me?", "I have configured my MySQL Database to require passwords on all users, even root from the machine itself. Now I discovered that there are empty Users in my Database Reproduce: mysql -u root -p and then use mysql; &amp; select * from user; It gives me 2 entries, one with \"localhost\" and user &lt;empty&gt; and one with the machine's hostname and &lt;empty&gt;. Now I tried to access the account with mysql -u ' ' (yes it's correct, leave a space between the ' things) and I log in without a password. The user can \"only\" see information_schema and test, the two databases created by default. He does not has access to mysql or any other custom created databases. I already changed the Password of this user to something I won't tell you mysql -u root -p use mysql; UPDATE mysql.user SET Password=PASSWORD('thisisasecretpassword') WHERE USER='root'; FLUSH PRIVILEGES; Now my Questions: Is any MySQL Server vulnerable for an attack with this entry? Could an attacker break out of this account or the two default databases? Should I password-protect those Users or can I delete them? Are They required for some MySQL-internal things?", "Why is \"high\" pronounced \"hiy\" but is not spelled that way?", "Proving that if $A$ is a $8\\times 8$ matrix over $\\mathbb{R}$ and $A^3=A$, then $A$ is diagonalizable.", "Using customized Coordinate System in ArcGIS Desktop? I don't know so much about coordinate systems... In my office we use to deal with spatial data coming from archaeological sites. Each site has its own x-y-z coordinate system (GCS). Three simple ortogonal cartesian axis. In the last years we have been managing this spatial data through GIS software (ArcGIS), without using specific coordinate system (just leave it as \"undefined\") I'd like to know if there exisits any GCS designed to deal with such datasets using simple cartesian orthogonal axis, without grid distortions of the typical GCS. In addition, I'd like to know if this system is suitable for using it in an online mapping application. By the way, we manage 2D (ArcMap) and 3D (ArcScene) environments and work with \"mm\" as length base unit. If such a thing doesn't exists, maybe someone knows how to create it.", "Prove that if b is coprime to 6 then $b^2 \\equiv 1 $ (mod 24) Let $\\gcd(b,6) = 1$. Prove that $b^2 \\equiv 1 $ (mod 24). Now I have that as $\\gcd(b,6) = 1$, we know that $3\\nmid b $ and $2\\nmid b$ (else the GCD would be 3 or 2 resp.) So as $2\\nmid b$, $b$ must be odd. Hence $b^2$ is also odd. Then I'm not sure where to take it from here? Maybe I've gone down the wrong path to start with, and should be looking more along the lines of the Chinese Remainder Theorem? I'm not sure.", "On duplicate questions, I often see different headings for the duplicate question list. These include: Possible Duplicate: [duplicate question list] and This question already has an answer here: [duplicate question list] and more recently, This question is an exact duplicate of: [duplicate question list] What decides which heading is placed before the duplicate question list?", "How to resolve a Java Rounding Double issue", "Short expression to convey \"but consider the source\"", "I was reading the following article by Mathew Might. I saw the following the paragraph What doesn't matter GPA? I don't care if it's 2.0 or 4.0. I won't even look at it. The school you went to? I'll judge you the same whether you went to Nowhere State U or a top-ten school. Transcripts? Never seen one. GREs? Irrelevant. Where you work/worked? Unless it's a research lab, it's not important. I don't think these items have much predictive capacity as to whether or not someone can complete a Ph.D. Is Mathew Might telling the truth? For me it's very hard believe that GPA, GRE scores and undergraduate school don't matter. I used to think that they play an extremely important role in grad school admission.", "Why did Bane/Smith cut himself? In the Matrix part II and the beginning of part III the crew member who was infected by Agent Smith (Bane) cuts himself. The female crew member in part III who brought Trinity food told her the same and speculated that they might be \"VDT's\". I don't fully understand this. What are VDT's and why would Agent Smith engage in self-cutting unless he has borderline personality disorder or depression or something?", "\"At\" vs. \"in\" before verb In a document I found the following sentence: listeners are more accurate at understanding speech spoken in their own accent... Would it be an error to use \"in\" instead of \"at\"? Actually in this case \"at\" sounds better than \"in\", but in general before verb is \"at\" always used?", "Is it correct to use the word \"birthday\" for the deceased, or is there a better alternative? How does one refer to the birthdate of someone who is no more, we usually say Today is my uncle's 80th birth anniversary (Common in Indian English, not sure if it's correct) or Today would have been my uncle's 80th birthday Is it right to say \"Today is my uncle's 80th birthday\" for an uncle who is dead?", "Is it required for panel data to use dummy variables? I am doing research considering seven countries and I have panel data. My question is: do I need to include dummy variables every time I use panel data in regression, or is enough to do it as a fixed effect in Stata, without dummy variables?", "General theorems for consistency and asymptotic normality of maximum likelihood I'm interested in a good reference for results concerning asymptotic properties of maximum likelihood estimators. Consider a model $\\{f_n(\\cdot \\mid \\theta): \\theta \\in \\Theta, n \\in \\mathbb N\\}$ where $f_n(\\mathbf x \\mid \\theta)$ is an $n$-dimensional density, and $\\hat \\theta_n$ is the MLE based on a sample $X_1, \\ldots, X_n$ from $f_n(\\cdot \\mid \\theta_0)$ where $\\theta_0$ is the \"true\" value of $\\theta$. There are two irregularities I'm interested in. The data $X_1, \\ldots, X_n$ are not iid and, as a result, the Fisher information about $\\theta$ accrues at a rate slower than $n$. $\\Theta$ is a bounded set, and with positive probability $\\hat \\theta_n$ lies on the boundary. The boundary corresponds to a \"simpler\" model, and so there is particular interest in whether or not $\\theta_0$ lies on the boundary. My particular questions are Letting $J_n(\\theta)$ denote the observed Fisher information corresponding to $\\theta$, and suppose $\\theta_0$ lies in the interior of $\\Theta$. Under what conditions is $$\\left[J_n(\\hat \\theta_n)\\right]^{1/2}(\\hat \\theta_n - \\theta_0)$$ asymptotically normal as $n \\to \\infty$? In particular, are the regularity conditions similar to the usual ones, with the relevant modification being $J_n(\\hat \\theta_n) \\to \\infty$ in some sense? Suppose instead that $\\theta_0$ is on the boundary, and again recall that $\\hat \\theta_n = \\theta_0$ happens with positive probability - for concreteness, in a mixed effects model $Y_{ij} = \\mu + \\beta_i + \\epsilon_{ij}$ we can have $\\hat \\sigma_{\\beta}^2 = 0$. Under what conditions does $\\hat \\theta_n \\to \\theta_0$ (almost surely or in probability) and under what conditions will $\\hat \\theta_n = \\theta_0$ eventually (this probably fails for the mixed effects model, but corresponds to \"oracle\" properties for the LASSO and related estimators, so perhaps it is too much to ask for general results)? Again, just a pointer to a text with results at this level of generality would be greatly appreciated.", "Azimuth and Distance, NumericalDigitize, Numerical Vertex Edit, XY tools and other plugins are not on QGIS Plugin Manager version 2.0.1 Will these plugins no longer be available in QGIS 2.0.1?", "How to obtain Hamiltonian formalism and phase space for Lagrangian with second-derivatives?", "How to plot points in a color corresponding to some value?" ]

[ "Can you play a Progress Card even when you get nothing from it? If I have a Progress Card for which initial preconditions do not hold, will I still be able to use it in order to discard it back to the pile? The goal is to prevent a spy from stealing it. A few examples: I am leading in victory points but I want to use Wedding card. I have Irrigation but I don't have any wheat hexagons. I have Blacksmith but I don't have any ore hexagons.", "Why queuable apex accepts sobjects where as future methods doesn't? I was going through asynchronous apex and reading it made me confused at one point. In future methods, we cannot pass sojects for reasons future methods being executed at a later point of time, by the time it is executed the sboject data could be stale. But, at the same time, the more advanced queuable apex accepts sobjects. Why is it so? The same reason is applicable for queuable apex also right? kindly clarify.", "GRUB does not detect Windows I have finally installed Ubuntu on my second drive. When I start my computer GRUB only offers me to boot Ubuntu, not Windows 7. What needs to be done so that I can choose between Ubuntu and Windows in GRUB? When I press F12 for boot menu at startup and I choose Windows Boot Manager it boots into Windows 7. I ran command sudo fdisk -l and here is log (): WARNING: GPT (GUID Partition Table) detected on '/dev/sda'! The util fdisk doesn't support GPT. Use GNU Parted. Disk /dev/sda: 1000.2 GB, 1000204886016 bytes 255 heads, 63 sectors/track, 121601 cylinders, total 1953525168 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 4096 bytes I/O size (minimum/optimal): 4096 bytes / 4096 bytes Disk identifier: 0xc3ffc3ff Device Boot Start End Blocks Id System /dev/sda1 1 1953525167 976762583+ ee GPT Partition 1 does not start on physical sector boundary.", "Method for determining irreducibles and factorising in $\\mathbb Z[\\sqrt{d}]$ I know that $\\mathbb Z[\\sqrt{7}]$ is a UFD, and I can write the equation $(2 + \\sqrt{7})(3 - 2\\sqrt{7}) = (5 - 2\\sqrt{7})(18 + 7\\sqrt{7}) $. So clearly these are not all irreducibles. How do I determine which of these aren't irreducible? How do I factor those into irreducibles? It seems difficult when dealing with $\\mathbb Z [\\sqrt{d}] $ with $d$ positive, since the norm map isn't as nice (it's not always positive). Thanks", "Changing plurality in parentheses If a set of parentheses lies between a subject and its verb, and the parentheses contain an substitutive subject whose singularity/plurality disagrees with the original subject, whose singularity/plurality should be chosen for the verb? In other words, in the following example, should \"questions\" (and its verb \"are\") be singular, or should they remain plural as shown? Many (if not every) questions on this StackExchange are answered. My intuition tells me that the two words in question should remain in plural forms, since the text in parentheses only interrupts the sentence (and the sentence would be grammatically incorrect if everything in parentheses were removed and the words were in singular form). On the other hand, when read aloud (assuming one reads the text in parentheses), this has an uncomfortable sound to it, and I've seen others write in what would be the above example's singular-form case, so I'm curious to find out which is correct. And, thinking about it, I suppose the same question would apply when commas are used in place of parentheses.", "Integral of $\\frac{1}{x^4+1}$ Just doing this for revision, seems much harder than it should be, should I use $x=\\tan u$ ? Any help appreciated.", "Allowing all/different file type uploads", "Replace Builtin commands with Custom Commands for CMD.exe", "I plan on buying Windows 7 Ultimate Edition to run on an old Pentium 4. I also want to run Windows 7 virtual machines inside Windows 7. My question is two fold: Do I need a license for each Virtual Machine? Does the answer change if I use a third party virtualization platform (e.g. , , , etc) as opposed to ?", "Autokey (autokey-qt) freezes and won't insert text", "Extruding surface while keeping the shape here is the picture of what I would like to get(example nr. 2). I need the edge frame to be same in width and length. Also the extrusion is on surface (without depth) I tried extruding region, but it did not give me the result I wanted. I know I could just adjust the scale and do it manually, but that would be eyeballing without achievign accuracy. I would like to know if it is possible to extrude or inset while keeping the shape (even edge space)", "For example, \"dude,\" \"man,\" \"buddy,\" \"pal,\" etc, when used to stand in for someone's name. \"Hey, pal, how's it going?\" Is there a word for terms like these? Or is \"colloquialism\" as close as we can get?", "What does \"\\\" mean in math In a Linear Algebra textbook I am reading, the following is stated: $b\\notin \\operatorname{span}(A \\cup \\{a\\})\\setminus \\operatorname{span}(A)$. It does so without explaining what \"$\\setminus$\" means. I apologize if this question does not belong here but I just want to understand what it means. I can close the question if someone just comments on its meaning.", "Automotive electronic circuit design, Voltage divider to uC ADC pin Automotive Circuit requirement: If input pin is connected to Battery(T87 line), the output of the circuit shall provide a output voltage of 5V to ADC pin of microcontroller, if the input pin is connected to GND, the output of the circuit shall provide a output voltage of 0V to ADC pin of microcontroller and if the input pin is left floating, the output of the circuit shall provide a output voltage of 2.5V to ADC pin of microcontroller. The battery voltage in load dump condition could be up to 60V, but in normal operation without any fault condition, it would be up to 32V. Would a simple voltage divider (with a pull-up to 5V) with a blocking diode be enough? Any other ideas? What parameters of the ADC of the microcontroller should be considered? Injection current into the uC- ADC pin would be critical, right? How do I find out the voltage thresholds? Also, what are the parameters of the Schottky diode that I should look to select? The diode would decouple the input pin from the centre tap of the voltage divider, because in case the input pin is connected to battery, the injection current into the uC ADC pin would be too high. I have used a switching diode, since it was already available in the Bill of Materials.", "Creating a virtual microphone", "interior points and limit points of $\\{(x,y): x^2+2y^2 < 1\\}$ Find out all interior points and limit points of $ A =\\{(x,y): x^2+2y^2 &lt; 1\\}$ I understand this problem graphically, but i'm not quite sure how to prove the answer rigorously using mathematical word. My try : Let k be an element of A, and suppose t is an element of $\\{(x,y):x^2+2y^2 =1\\}$, which makes minimum $||t-k||$. Then $N(k,\\delta)\\subset A$ when $\\delta = \\||t-k||$. I suppose this will work, but I want more clear and detailed proof. Thank you in advance.", "How does langid field in biblatex differ from language field? Could someone summarise the differences in the use of the langid field from language field in biblatex? Documentation to Gost package for bibtex says that langid is a synonym of language but has priority over it.", "I will be arriving in Mumbai Terminal T2 on a Turkish Airlines international flight. I have a separately-purchased IndiGo ticket 5 hours later from Terminal 1B (Domestic). In the past I heard of a free bus to transfer. Is that still the case and if not how do I get to Terminal 1B from Terminal 2?", "Solving of a seperable differential equation", "The default is that clicking on the folder in the unity dock opens the home directory. Since there are shortcuts for all the sub-folders of the home directory in the sidebar already, I'd prefer the default directory to move to a different location (~/Documents). How can I achieve this?" ]

[ "How to find a generator of a cyclic group?", "Local Coordinate to Geocentric The ultimate question, I need a transformation matrix to take a point in local space representing a roughly 500m x 500m place in New Mexico centered at -108.619987456 long 36.234600064 lat. The final output needs to be in geocentric coordinates and I can during initialization get any number of points on the map such as the corners, center, western most along the center etc. During run time I would like to have a transformation matrix that can be applied to a position in local space expressed in meters and get back an approximate GCC coordinate. The center of the point in GCC: -1645380 -4885138 3752889 The bottom left corner of the map in GCC: -1644552, -4881054, 3749220 During run time I need to be able to multiply (-250, -250, 0) with the transformation matrix and get something close to (-1644552, -4881054, 3749220). I've spent more than a week trying to research a solution for this and so far nothing. Given an identity matrix as our starting position and orientation. Then using geotrans and the known lat, long, and height of the starting position I get an x,y,z geocentric coordinate. A vector from the origin of (0,0,0) gives both the up and translation for the matrix. However, I need the forward and right so that I can pass a distance in meters from the origin into the transformation matrix and get a roughly accurate GCC. Do I have all of the inputs I need to calculate the right and forward? Inputs Origin: 0, 0, 0 Global: -1645380, -4885138, 3752889 Up (Normalized): Global - Origin Desired Outputs Right: ? ? ? Forward: ? ? ? So with the right and forward added to the up and translation I already calculated I would have a transformation matrix. I could then apply the matrix to a vector of say (50, 50, 0) and get something within about 0-3 cm of the output if I feed the lat/long back into geotrans. This matrix would only ever be used small maps of about 500m x 500m so the curvature of the earth is negligible. In reply to whuber, I don't know your level of experience so I will start with the very basics. An identity matrix is a 4x4 matrix that you can multiply by a vector and it returns the vector unchanged. Such as below. 1 0 0 x=0 0 1 0 y=0 0 0 1 z=0 0 0 0 1 The x, y, and z of the matrix are how much to translate the vector by and the first 3 rows and columns are the rotation. Below is a tranformation matrix that does nothing to the orientation of a vector but does translate. This is what you would want for two axis aligned worlds in different locations. 1 0 0 13 0 1 0 50 0 0 1 -7 0 0 0 1 If you were to multiply a vector of (10, 10, 10) with the above transformation matrix you would get an output of (23, 60, 3). My problem is the axes are not aligned and the \"plane\" of the world I am trying to get the local coordinate converted to is projected on the ellipsoid of the earth. Geotrans is library that you can use to pass a coordinate from one system such as geodetic or GDC (lat, long, height) and get back another such as geocentric or GCC (x,y,z). For example: If my game world was representing a map centered exactly on the prime meridian and equator the transformation matrix would look something like below. I am just guesstimating the Y and Z rotations and might have them flipped and/or the wrong sign. 0 0 1 6378137 0 1 0 0 1 0 0 0 0 0 0 1", "How did R.A.B get to know about Voldemort's Horcruxes?", "I want to create posters for my poster presentation on a conference. What tools or LaTeX classes are available for preparing posters ?", "How do I install minecraft 1.9 on mac?", "Variable doesn't get returned from AJAX function", "How to create dynamic JSF form fields", "How would I implement the quantum oracle in Deutsch's algorithm?", "How do I enumerate the properties of a JavaScript object?", "How do I get a consistent byte representation of strings in C# without manually specifying an encoding? How do I convert a string to a byte[] in .NET (C#) without manually specifying a specific encoding? I'm going to encrypt the string. I can encrypt it without converting, but I'd still like to know why encoding comes to play here. Also, why should encoding even be taken into consideration? Can't I simply get what bytes the string has been stored in? Why is there a dependency on character encodings?", "Solve the equation $28^x = 19^y+87^z$ in integers", "Why are \"baked\" and \"naked\" not pronounced the same?", "What is the command line way of sending files to the recycle bin? Is there a command line program that can send files to the recycle bin? This is on XP and Vista.", "Degrees of freedom for standard deviation of sample would someone please explain why the degrees of freedom for a random sample is n-1 instead of n ? I'm looking for an explanation that is intuitive and easily understood by a high school student.", "Minimum eigenvalue and singular value of a square matrix How to show that the relationship $\\left | \\lambda_{min} \\right | \\geq \\sigma_{min}$ holds between the minimum eigenvalue and singular value of a square matrix $A \\in \\mathbb{C}^{n \\times n}$?", "Dual Channel RAM vs. Quad Channel RAM I just bought a motherboard that says it supports Dual-Channel RAM. The RAM I'm looking at says it's a \"Quad-Channel Kit\" . Will it work with my motherboard? EDIT: Thanks all for the replies. Here is some more info: Here is the RAM I'm looking at: It all looks compatible to me, I just was curious about the four channel thing.", "\"Unable to locate package\" while trying to install packages with APT", "Checking for a null int value from a Java ResultSet", "Keyboard shortcut to switch between applications in Mission Control Does Apple have keyboard shortcuts to switch between applications in Mission Control? (Instead of hovering over with the cursor)? e.g., which key combination cal I press to get me from \"preview\" to \"app store?\"", "Spam iCloud Calendar Invitations" ]

[ "How do I figure out who's been banished to the penalty box recently?", "What is the safest way to clean up /boot partition? I have 200 MB assigned for the /boot partition. Whenever I try to update the kernel, I receive an error message that basically states /boot is full. What can I do to cleanup /boot and remove/backup the older kernels?", "I was working on a tower and painted my own texture for it. I saved halfway though and took a break. When I returned to my little project, I could paint on the image and it shows up in the material view but not the render. I did everything in my power but still couldn't understand why? I have used: Nodes, including mapping and insert UV coordinates. Unwrap UVs Used lights Deleted and replace nodes Deleted and replace Mat Removed image and replace it Reload image Painted on mesh Even though use blender, I am not a programmer. So I find it really helpful if someone could give me an answer.", "Why does putting a 1/2 in front of the squared error make the math easier?", "Why are these pistons pushing? I've lately become hooked into building computers in Minecraft and today I decided to build a giant hard drive. I've built HDDs before, but not at the scale I'm currently attempting, and I anticipated problems. As I was wiring some pistons, they activated and pushed forward oddly. As far as I can tell, there's nothing powering them. I thought at first that it might be the redstone torches (top left of above pic) but they aren't powered. Here's a top view of the same pistons. I also thought the line of redstone above them might be the problem (middle of above pic), but when I destroy it, the pistons stay extended. Is there a reason why my pistons are extending? If so, is there a way to get them to power (when I want them to) without disturbing the pistons above?", "Exit from both root and user with one command I know about \"not using sudo su -\" etc. But let's be honest, almost all of us do it. So, here is the issue. We can't have root logins enabled, so we have to ssh in as our user then su to root. Here is the process tree: 1 7897 7826 7826 ? -1 S 1000 0:00 sshd: josh@pts/0 7897 7898 7898 7898 pts/0 8182 Ss 1000 0:00 \\_ -bash 7898 7990 7990 7898 pts/0 8182 S 0 0:00 \\_ sudo su - 7990 7991 7990 7898 pts/0 8182 S 0 0:00 \\_ su - 7991 7992 7992 7898 pts/0 8182 S 0 0:00 \\_ -su 7992 8182 8182 7898 pts/0 8182 R+ 0 0:00 \\_ ps axjf I would like to exit from root, then from my user with one command. Is there a way to do this? BTW exit &amp;&amp; exit does not work because it exits the shell and doesnt process the rest of the command josh@ubuntu:~$ sudo su - root@ubuntu:~# exit &amp;&amp; exit logout josh@ubuntu:~$", "How do exchanges match limit orders?", "What is the difference between a \"proof by contradiction\" and \"proving the contrapositive\"? Intuitive, it feels like doing the exact same thing. And when I compare an exercise, one person proves by contradiction, and the other proves the contrapositive, the proofs look almost exactly the same. For example, say I want to prove: $P \\implies Q$ When I want to prove by contradiction, I would say assume this is not true. Assume $Q$ is not true, and $P$ is true. Blabla, but this implies $P$ is not true, which is a contradiction. When I want to prove the contrapositive, I say. Assume $Q$ is not true. Blabla, this implies $P$ is not true. The only difference in the proof is that I assume $P$ is true in the beginning, when I want to prove by contradiction. But this feels almost redundant, as in the end I always get that this is not true. The only other way that I could get a contradiction is by proving that $Q$ is true. But this would be the exact same things as a direct proof. Can somebody enlighten me a little bit here ? For example: Are there proofs that can be proven by contradiction but not proven by proving the contrapositve?", "How to check if jQuery.ajax() request header Status is \"304 Not Modified\"?", "C non-blocking keyboard input", "Why is a T distribution used for hypothesis testing a linear regression coefficient? In practice, using a standard T-test to check the significance of a linear regression coefficient is common practice. The mechanics of the calculation make sense to me. Why is it that the T-distribution can be used to model the standard test statistic used in linear regression hypothesis testing? Standard test statistic I am referring to here: $$ T_{0} = \\frac{\\widehat{\\beta} - \\beta_{0}}{SE(\\widehat{\\beta})} $$", "Should VMware Tools always be installed in headless Linux guests? We have a deployment with what I would call an Enterprise Cloud Provider. It's VMWare Infrastructure 3.5.x and includes VMotion / VMWare HA instances, etc. At Provider 1 VMWare Tools was installed: vmware-guestd is running and; at least two kernel modules are loaded, vmmemctl &amp; vmhgfs Provider 1 does nightly VM Snapshots. We are beginning a new deployment at Provider 2 (also an Enterprise Cloud Provider). They did not install VMWare Tools. Provider 2 does not do nightly VM Snapshots but rather file-system backups (using an agent). From my reading it seems like at the very least VMWare Tools should be installed for the Memory Balloon Driver (vmmemctl) and from reading sources like it suggests that certain VirtualCenter management operations also depend upon VMWare Tools being installed in the Linux guest. Note that all of our instances are headless (default runlevel is 3) and RHEL. It is hard to find authoritative information on this question and the aforementioned source is somewhat dated. Can someone shed some light on this? What are the factors/criteria that would lead to an answer in the affirmative or negative? TIA Cheers", "Intuituive reason why Fermats last theorem holds I am unsure of whether it is normal, but to me, intuitively Fermats last theorem should not hold. If anyone intuitively believed it to be correct, why? Can someone explain so I understand somewhat why FLT holds without reading a massive and complex proof?", "Returning multiple values from a C++ function", "Define $\\mathcal N$ $\\mathcal N (A):=\\mathcal P(A)\\setminus\\{\\varnothing\\}$ Does $\\mathcal N$ has a special name and standard notation?", "By looking at an integral and bounding the error?", "File sync error (AUTH_FAILED)", "\"really not\" vs \"not really\" If someone says \"David is not really a leader\", it means something like: the speaker believes that David isn't the kind of person you would think of as a without-doubt a real leader; but the speaker isn't necessarily saying that David is definitely a very poor leader. If someone says \"David is really not a leader\", it means that the speaker thinks that David is definitely a very poor leader. What analysis (grammatical, dictionary, etc?) can help me understand how this difference in meaning is created?", "This is my circuit. I need to find the power dissipated by Vlamp. So the lamp turns on if the Vlamp is more than 2V. When the lamp is on it has an internal resistance of 10 Ohms, and when it is off it acts like an open circuit. How would I find the power dissipated? I know how to do it for Voltage sources and Resistors, but not elements like these. One more thing, I already figured out that: Battery has open circuit voltage of 4V R1 = 5 Ohms R2 = 5 Ohms k = 0.2A/V When lamp on and Vlamp = 2V, Rbat = 10 Ohms .", "Navigation bar is too long on progressbar theme, can it wrap? My navigation bar at the top of each slide (that links to each section) has too many sections. I would like to keep the bar and keep each section but I would like to wrap it i.e. have it on two lines. Is that possible? I am using compress and I am using as a theme." ]

[ "How to add “jQuery” onclick functionality for a column each row in jQgrid to display different popups for different rows", "How do I get the number of days between two dates in JavaScript? How do I get the number of days between two dates in JavaScript? For example, given two dates in input boxes: &lt;input id=\"first\" value=\"1/1/2000\"/&gt; &lt;input id=\"second\" value=\"1/1/2001\"/&gt; &lt;script&gt; alert(datediff(\"day\", first, second)); // what goes here? &lt;/script&gt;", "In Windows I used command-line clipboard copy-and-paste utilities... pclip.exe and gclip.exe These were UnixUtils ports for Windows (but they only handled plain text). There were a couple of other native Windows utilities which could write/extract any format. I've looked for something similar in Synaptic Package Manager, but I can't find anything. Is there something there, that I've missed? ... or maybe this is available in Bash scripting? The type of utility I'd like will be able to read/write via std-in/std-out or file-in/file-out, and handle Unicode, Rich Text Format, picture, etc. clipboard formats... NB: I'm not after a clipboard manager.", "How can I start automatically a command on Ubuntu 18.04?", "Does $\\sum\\limits_{k=1}^n 1 / k ^ 2$ converge when $n\\rightarrow\\infty$? I can prove this sum has a constant upper bound like this: $$\\sum_{k=1}^n \\frac1{k ^ 2} \\lt 1 + \\sum_{k=2}^n \\frac 1 {k (k - 1)} = 2 - \\frac 1 n \\lt 2$$ And computer calculation shows that sum seems to converge to 1.6449. But I still want to know: Does this sum converge? Is there a name of this sum (or the series $\\frac{1}{k^2} $)?", "Contains and Custom Label in Rule Criteria - Workflow I have a picklist field-XYZ which contains a lot of values.Lets say (A,b,c,d...z) I am trying to write a rule criteria which will execute if the picklist value is any of the following (A,b,c...p).So instead of mentioning all the values in rule criteria , i created a custom label and put the values (a,b,c,d..p) in that and wrote the following in the rule criteria : CONTAINS(TEXT(XYZ__c) ,$Label.CustomLabel)) This is not working even is the value of the picklist is equal to the one mentioned in the Custom Label.I guess the CONTAINS function is matching the whole value of custom label with Picklist.Is there other workaround/solution for this?", "What is the inverse of CoefficientList?", "How can I simulate a slow machine in a VM?", "HTML text input allow only numeric input", "The functions of each pair are inverse to each other. For each pair, check that both compositions give the identity function. $F: \\mathbb{R} \\to \\mathbb{R}$ and $F^{−1}:\\mathbb{R} \\to \\mathbb{R}$ are defined by $F(x)=3x+2$ and $F^{−1}(y)=\\dfrac{y−2}{3}$. for all y ∈ R My attempt: Inverse Function For each particular but arbitrarily chosen $y \\in \\mathbb{R}$, according to the definition of $f^{-1}$, $f^{-1}(y) = \\dfrac{y-2}{3}$ is a unique real number $x$ such that $f(x) = y$. \\begin{align*} F(x) &amp; = y\\\\ 3x + 2 &amp; = y\\\\ x &amp; = \\frac{y-2}{3} \\end{align*} Therefore, $f^{-1}(y) = \\frac{y-2}{3}$. Compositions of Functions The functions $g \\circ f$ and $f \\circ g$ are defined as follows: $$(g \\circ f)(x) = g(f(x)) = g(3x + 2) = 3x + 2$$ for all $x \\in \\mathbb{Z}$.", "I've found plenty of posts about changing the visibility of a block programatically. My problem is the opposite. Given a block's ID/delta, how do I find out if it should be displayed at the current path? I have a field collection that allows you to append a block using the Block Reference module (I preprocess the field collection and use my own template, so the logic has been taken away from the Block Reference module). It works, but I only want it to kick in if the \"Show block on specific pages\" rule says that block should be displayed.", "Custom plugin giving: wp-admin/admin-ajax.php 400 (Bad Request) I am having trouble debugging an issue with a plugin that I'm writing. I want to do an Ajax request when a user changes the option on a select input. The thing is it was fully working as expected yesterday, then when I test the website today (no code changes were made at all since yesterday) I'm getting an: domain.com/wp-admin/admin-ajax.php 400 (Bad Request) message in my Chrome console. If I try in Internet Explorer/FireFox it doesn't give the error in console but the Ajax request is still not working. The plugin I'm creating is on a DigitalOcean droplet which was made using their one click app for WordPress. Here is the barebones code I'm using on the plugin for the ajax: //This is in a class' constructor method add_action('wp_enqueue_scripts', array($this, 'plugin_prefix_scripts')); //PLUGIN_URL is a constant created earlier in the plugin public function plugin_prefix_scripts() { wp_enqueue_script('plugin_prefix_scripts', PLUGIN_URL . 'scripts/frontend_script.js'); wp_localize_script('plugin_prefix_scripts', 'js_object', array( 'ajax_url' =&gt; admin_url('admin-ajax.php') ) ); } frontend_script.js: $('#plugin-prefix-option-one, #plugin-prefix-option-two').on('change', function() { var data = { 'action': 'plugin_prefix_page_change', 'option_val': 'some_val', } $.post(js_object.ajax_url, data, function(response) { console.log(response); }); Back in the class: add_action('wp_ajax_plugin_prefix_page_change', array($this, 'plugin_prefix_page_change')); public function plugin_prefix_page_change() { $arr = array(1, 2, 3, 4, 5); wp_send_json($arr); //I've also tried wp_die() and no die call at all but same outcome die(); } I'm unsure how to debug this further. Any help is much appreciated. Thanks", "How this java code produces deadlock?", "Is there a fast way (without looping over all edges/faces/verts) using ops.mesh or bmesh to get the lists of indices associated with mesh islands as shown below? These islands are part of one mesh but are disjoint from each other. I know how to select the boundaries by running the operator Select boundary Loop or calling bpy.ops.mesh.region_to_loop() but can't find any API calls to return the vert/edge/face indices associated with the individual islands.", "How to validate an email address in JavaScript Is there a regular expression to validate an email address in JavaScript?", "Unable to see anything after importing .obj file", "Is it a goal if, during kicks from the penalty mark, the ball goes outside the penalty area and then into the goal?", "The following is an excerpt from Folland's Introduction to Partial Differential Equations: Let the open set $\\Omega\\subset{\\mathbb R}^n$, and $k$ be a positive integer. $C^k(\\Omega)$ will denote the space of functions possessing continuous derivatives up to order $k$ on $\\Omega$, and $C^k(\\overline{\\Omega})$ will denote the space of all $u\\in C^k(\\Omega)$ such that $\\partial^{\\alpha}u$ extends continuously to the closure $\\overline{\\Omega}$ for $0\\leq|\\alpha|\\leq k$. As I understand, an extension means that there exists $\\widetilde{\\partial^{\\alpha}u}$ which is defined on $\\overline{\\Omega}$ and $\\widetilde{\\partial^{\\alpha}u}|_{\\Omega}=\\partial^{\\alpha}u$. And \"extends continuously\" means $\\widetilde{\\partial^{\\alpha}u}$ is continuous with respect to the relative topology on $\\overline{\\Omega}$. Here are my questions: How do people usually do such extension? When does such extension exist and when does not? Let $\\Omega$ be an open subset of ${\\mathbb R}$. Is there any non-trivial counterexample such that this kind of extension does not exist?", "Does there exist a holomorphic function with the following property?", "I'd like to highlight paragraphs such that the highlight color appears as one whole rectangle underlying the entire paragraph. I have looked around but nothing gives me the desired effect so far. For example \\fcolorbox{} from xcolor cannot highlight an entire paragraph; \\hl{} from soul leaves out spacings between lines uncolored. I am wondering how I can do this?" ]

[ "I have just bought a new computer and I have everything migrated over except for my Steam games. I looked in Program Files/Steam/ and I found a folder full of the games I have downloaded, but I do not know if it is safe to just copy these folders from one computer to another (seeing as a lot of other applications will not work if you do this), or is there another recommended way? I don't really feel like re-downloading all my games. I don't have the time nor bandwidth to download 20GB over a 1.5mbps connection. Is it possible to contact Valve and get a disk with the games on it?", "Stacking Multiple Ternary Operators in PHP", "Limit of ${a_n}^{1/n}$ is equal to $\\lim_{n\\to\\infty} a_{n+1}/a_n$ Today my lecturer put up on the board that: If $\\lim\\limits_{n\\to\\infty}\\frac{a_{n+1}}{a_n}$ exists and $a_n&gt;0$ then $\\displaystyle \\limsup\\limits_{n\\to\\infty}\\left(a_n^{\\frac{1}{n}}\\right)=\\lim_{n\\to\\infty}\\frac{a_{n+1}}{a_n}$ however I am not sure why this is true, can somebody give me a hint or something as to how to go about proving this. thanks for any help", "Can I call a constructor from another constructor (do constructor chaining) in C++? As a developer I'm used to running through constructors: class Test { public Test() { DoSomething(); } public Test(int count) : this() { DoSomethingWithCount(count); } public Test(int count, string name) : this(count) { DoSomethingWithName(name); } } Is there a way to do this in C++? I tried calling the Class name and using the 'this' keyword, but both fail.", "Uses of the definite article (the) in generic noun phrases I was reading a paragraph about lions and I came up with a question about the definite article (the). Let me tell you first what I know about it. 1->We use the before a singular noun (when we are sure about the noun. And the listener and the speaker both know about it). 2->We use the before a plural noun (again when we are sure about the noun, and we are not talking generally). So, my question is why does the writer use the here as we are not talking about any specific lion or lions. We are talking generally. The Paragraph: Living in the grasslands, scrub, and open woodlands of sub-Saharan Africa, the lion is the second largest cat in the world. It is dwarfed slightly by the tiger, which is closely related and has a very similar body type. Can we re-write the paragraph something like this: Living in grasslands, scrub, and open woodlands of sub-Saharan Africa, lions are the second largest cat in the world. They are dwarfed slightly by tigers, they are closely related and has a very similar body type.", "If I wave around a bar magnet, the magnetic field in the space around it changes. Is this enough to go through the whole speed of light derivation implying that the motion creates an electromagnetic wave? If so how do I determine the wavelength and direction of the resulting wave?", "How to do binary calculation？", "How to connect to Oracle as \"SYS\" from SQL*Plus in Java", "What visa does my wife need to travel to the UK with me, if I'm going there on a business visa? I am resident of India and just got UK Business visa ( 6 months, multiple entry) .. I am going for a week on business trip. I want to take my wife along with me and at the end of trip.. I want to extend my trip for 3 days and we want to spend some time on leisure. What visa I should apply for my wife.. visitor visa? should she mention in the visa form that she is going along with me and staying with me while I am on work and later we are spending time on leisure. While filling my business visa form, there was a field asking if anyone else is going with me.. I selected no.. as there were no plans. Also is it ok to spend time on leisure on UK Business visa", "Finite Sum $\\sum\\limits_{k=1}^{m-1}\\frac{1}{\\sin^2\\frac{k\\pi}{m}}$", "Undefined variable as function argument javascript", "$|f(x)-f(y)|\\geq k|x-y|$.Then $f$ is bijective and its inverse is continuous. My exercise says: Let $f:\\mathbb{R} \\rightarrow \\mathbb{R}$ a continuous function e suppose that exists $k$ such that: $$|f(x)-f(y)|\\geq k|x-y|$$ Then $f$ is bijective and its inverse is continuous. Well, there's a Theorem , Invariance of domain, that says \"If $U$ is an open subset of $\\mathbb {R^n}$ and $f : U \\rightarrow\\mathbb{R}$ is an injective continuous map, then $V = f(U)$ is open and $f$ is a homeomorphism between $U$ and $V$\". But I'm not knowing how to proceed...need a clue...Thanks for attention!!!", "If $\\mathop{\\mathrm{Spec}}A$ is not connected then there is a nontrivial idempotent", "How can I change an element's class with JavaScript?", "Contacts in Mavericks Messages display phone numbers instead of contact names Since updating to Mavericks the Messages app doesn't display the contact names for people I've been communicating with iMessage, it shows their phone number instead. My messages thankfully still stay synced between my iPhone and Messages on Mavericks.", "Can I travel domestically within the United States with my USA expired passport? I need to fly domestically within the United States. The only ID I have is an expired USA passport. Can I use that to pass T.S.A.? Can I use it as ID?", "What is the \"Wanna Cry\" ransomware's possible impact on Linux users? It's just come to light that there's a $300 ransom you have to pay because ransomware targeting Microsoft Windows has encrypted your data. What steps do Linux users need to protect from this if for example they are using wine? This ransomware is widely reported to be based on a tool developed by the NSA to hack into computers. The NSA tool was used by a hacker group called the Shadow Brokers. The code can be found in . Microsoft released a patch (MS17-010) against this vulnerability on March 14, 2017. The mass infection is reported to have begun spreading on April 14th. This is discussed . As I haven't booted Windows 8.1 in 6 to 8 weeks, can I apply this patch from Ubuntu without booting Windows first? (After research it may be possible ClamAV could report the vulnerability from the Linux side looking into Windows partition but it's unlikely it could apply the patch. The best method would be to reboot into Windows and apply patch MS17-010.) Individuals and small companies who subscribe to Microsoft Automatic Updates are uninfected. Larger organizations who delay apply patches as they are tested against organization intranets are more likely to be infected. On May 13, 2017, Microsoft took the extraordinary step of releasing a patch for Windows XP which has been unsupported for 3 years. No word if wine is doing anything about a security update. It was reported in a comment below that Linux can be infected too when users run . An registered a domain name that acted as a kill-switch to the ransomware. I presume the non-existent domain was used by the hackers on their private intranet so they didn't infect themselves. Next time they will be smarter so don't rely on this current kill-switch. Installing the Microsoft patch, which prevents exploiting a vulnerability in the SMBv1 protocol, is the best method. On May 14, 2017 Red Hat Linux said they are not affected by \"Wanna Cry\" ransomware. This might mislead Ubuntu users along with Red Hat, CentOS, ArchLinux and Fedora users. Red Hat supports wine which answers below confirm can be effected. In essence Ubuntu and other Linux distro users googling this issue might be mislead by the Red Hat Linux Support answer . May 15, 2017 Update. Over the last 48 hours Microsoft released patches called KB4012598 for to protect against \"Wanna Cry\" ransomware. These Windows versions are no longer on automatic updates. Although I applied security update MS17-010 on my Windows 8.1 platform yesterday, my old Vista Laptop still needs patch KB4012598 downloaded and manually applied. Moderator note: This question is not off topic - it asks about whether or not any Linux users need to do any steps for protecting against the risk. It is perfectly on topic here, because it's relevant to Linux (which Ubuntu is), and it's also relevant for Ubuntu users running Wine or similar compatibility layers, or even VMs on their Ubuntu Linux machines.", "Strict warning: Only variables should be passed by reference I get the following error: Strict warning: Only variables should be passed by reference in include() (line 18 of /home/sites/dev/theparce/sites/all/themes/parce/block--block--3.tpl.php). This is the block code which is causing that error. if ($user_gallery) { print render(node_show($user_gallery)); // Line 18 print drupal_render ($user_gallery_edit); } else { print drupal_render($user_gallery_new); } Why do I get that error, even if I get all printed as expected?", "Truly destroying a PHP Session?", "Transforming multiple rows into a single row" ]

[ "How do I disable fog on specific camera/s", "How to include python script inside a bash script", "Adventurer enters an other-dimensional realm where he repeatedly dies unexpectedly and wakes up in reality", "Why don't we define division by zero as an arbritrary constant such as $j$? Why don't we define $\\frac 10$ as $j$ , $\\frac 20$ as $2j$ , and so on? I know that by following the rules of math this eventually leads to $1=2$ , but we could make an exception and say that $j$ is the only number such that $0*j \\not= 0$ , and put other restrictions necesary so that we don't get contradictions. We do this for $i$ , so why can't we do it here? For example, $i^2$ , is defined as $-1$ , but you could also say $i^2=\\sqrt {-1} *\\sqrt {-1}=\\sqrt {(-1)(-1)}=\\sqrt{1}=1$ , but we make an exception for this.", "What is $dx$ in integration?", "Let $(e_n)$ (where $ e_n $ has a 1 in the $n$-th place and zeros otherwise) be unit standard vectors of $\\ell_\\infty$. Why is $(e_n)$ not a basis for $\\ell_\\infty$? Thanks.", "Cron Job not working in plugin I have written a plugin that will convert posts to excel format and then email the .xls to an email id. I can make it work with when function is declared in functions.php but does not work with function defined in plugin file. if ( ! wp_next_scheduled( 'xls_func_hook1' ) ) { wp_schedule_event( time(), 'hourly', 'xls_func_hook1' ); } add_action( 'xls_func_hook1', 'sendxls1' ); //senxls1 is a function in functions.php if ( ! wp_next_scheduled( 'xls_func_hook2' ) ) { wp_schedule_event( time(), 'hourly', 'xls_func_hook2' ); } add_action( 'xls_func_hook2', 'export2excel' ); The full code is at", "Why do single-author community wiki answers (or questions?) link to revisions, rather than to the author's profile? Possible Duplicate: Looking at , I noticed something peculiar: Community Wiki posts* with only one author have not one, but two different links to the revisions page. Is this entirely necessary? When clicking on the author's name in this case, I entirely would expect to be brought to the author's profile, rather than to the (potentially one-item-long) revisions list. *(maybe only answers? couldn't find any good single-author CW question references)", "Zorn's lemma and maximal ideals Let's consider two statements: Zorn's lemma and theorem about existence of maximal ideals in commutative ring with $1$. It's easy to prove that Zorn's lemma implies existence of maximal ideals. I wonder if the converse proposition is true, i. e., does existence of maximal ideals implies Zorn's lemma? My approach was to construct a ring structure on an ordered set which satisfies Zorn's lemma condition such that existence of maximal ideal implies existence of maximal element in the set, but I didn't succeed.", "Just curious as to how to obtain item drops from the last update. To clarify, item drops as in weapon skins, crates, anything else Valve added without letting us know, etc. It seems that after playing a bit, I've gotten no drops, but I've seen players who've gotten drops after a few short minutes of gameplay, but I've been playing for hours. Is the item drop system like TF2, where you can just idle, get an item drop, come back? Is it like Dota2, where you have to be in the matchmaking system and complete matches for the chance to get drops? Or do you have to be MvP to get item drops? Is it a certain time you play the game? Also, are weapon and crate drops independent or dependent on each other? Meaning, is the drop counter shared between Weapons and Crates, or are they both separate drop counters?", "How to get more info out of the uninformative Windows 8 BSOD?", "Performance evaluation of auto.arima in R and UCM on one dataset I started evaluating and comparing some methods in forecasting. I used Price of dozen eggs in US, 1900–1993, in constant dollars in the R software FMA package. I held out the last 10 years for assessment of forecast. Below are the results: I used auto arima method in the R software. Obviously the results are way off. Am I doing something incorrect ? Below is the forecast. It does not recognize the declining trend. I also used an unobserved components model (UCM) and obtained a good forecast, as below. Without outliers/level shifts there are very large standard errors and therefore wide confidence bands. After some iterative work, below is the output with outliers/level shifts (I know I'm overfitting here) but it did a pretty good job in forecasting; there are also narrow confidence bands. In looking at just this example the UCM seems to predict the hold-out sample more accurately than auto.arima. Why is auto.arima not providing a reasonable forecast? Are state space models/UCMs better for forecasting long range? Are there any benefits of using one method over other?", "The origin of spin is some what a puzzle to me, everything spin from galaxies to planets to weather to electrons. Where has all the angular momentum come from? Why is it so natural? I was also thinking do photons spin? we always think of the wave as a standard 2d sin wave but could this rotate in 3d? What implications would this have? And what about spacetime how does all the spinning effect? This has always been avoided in all lectures and classes I ever went to.", "How to run adb and fastboot commands from Termux?", "How can I send an email using a template? I have created a email template in ExactTarget API and I want to use it executing XML from SoapUI. Is there any tutorial or examples of how can this be done? I'm new at this and I'm not sure how ExactTarget really works.", "How many ways can we let people into a movie theater if they only have half-dollars and dollars? My interest in combinatorics was recently sparked when I read about the many things that the Catalan numbers count, as found by Richard Stanley. I picked up a copy of Brualdi's Combinatorics, and while browsing the section on counting sequences I found a nice little puzzle that has definitely puzzled me. Let $m$ and $n$ be nonnegative integers with $n\\geq m$. There are $m+n$ people in line to get into a theater for which admission if $50$ cents. Of the $m+n$ people, $n$ have a $50$-cent piece and $m$ have a $\\$ 1$ dollar bill. The box offices opens with an empty cash register. Show that the number of ways the people can line up so that change is available when needed is $$ \\frac{n-m+1}{n+1}\\binom{m+n}{m}. $$ I first noted that the first person to enter must be one of the $n$ with a half-dollar. Now the register has a half-dollar change. The second person can be either a person with a half-dollar or a dollar. In the first case, the register will now have two half-dollars, in the second case, the register will now have one dollar bill. So it seems to me that when one of the $n$ people with a half-dollar enters, the number of half-dollars in the register increases by $1$, and when one of the $m$ people with a bill enters, the number of half-dollars decreases by $1$ but the number of bills increases by $1$. I tried to model this by looking at paths in $\\mathbb{Z}^2$. The $x$-axis is like the number of half-dollars, and the $y$-axis is the number of bills. You start at $(0,0)$, and you can take steps forward $(1,0)$ or backwards diagonally $(-1,1)$ corresponding to who enters, but you must always stay in the first quadrant of the plane without crossing over the axes. The goal is to make $m+n$ moves, and I figured maybe the number of such paths is counted by $\\frac{n-m+1}{n+1}\\binom{m+n}{m}$, but I'm not sure how to show this. I don't know if this observation simplifies the problem at all, as I don't know how to finish up. I'd be happy to see how this problem is done, thank you.", "My colleague is using an application that consumes a lot of memory which makes the system too slow. Is it possible to share memory with other PCs over the Internet? The system has 8 GB of RAM, and the application consumes more than 6 GB.", "WiFi not working Kubuntu 20.04 - Intel 8265 Network Interface", "How to get ObjectContext to compile?", "Where are static variables stored in C and C++?" ]

[ "Can we know the fundamental nature of space and time?", "Boggle: What is the dice configuration for Boggle in various languages? This is the dice configuration for the English Boggle: Other variants and discussions concerning letter distributions for English can be found here: , , , (Wikipedia). I am interested in the 16 dice configurations for also other languages (Spanish in particular) and I am unable to find it anywhere online. Versions I have managed to find so far: , English 25 dice version: Spanish 25 dice version: Italian 25 dice version:", "Putting a piece of code in between two html tags in Solaris", "So I had asked a question prior to this one about recurrence relations, but apparently it was a bad one to ask. So I'm trying again to understand how to solve these babies... Here it is: $$ 3a_{n+1}-4a_n=0, n&gt;=0, a_1=5 $$ What is the general process for solving a relation like this?", "List questions: Community Wiki?", "swap x and y axis on data generated plot", "How often did Gandalf return to Hobbiton after the events of The Hobbit? It has been a while since I read the Lord of the Rings novels (don't have a copy at the moment) but I seem to recall he went to Hobbiton at least once, as the young hobbits were always excited to see him. Did he travel there often?", "Within my web application directory, how can I change all my folder permissions to rwxr-xr-x (755)? And how can I change all file permissions to rw-r--r-- (644)? I want to change all folders and files including sub-sub files and folders. I know the following command would change all files and folders but I want to discrimate between a file and a folder. chmod -R 755 ./my_web_app_project", "Show all of my question/answers to me even if they are deleted I would really like to see all of my questions and answers on the profile page, even if some of them were deleted, and I don't have enough rep to see them on the site. (Note that some questions are after 30 days or 1 year, and the author might be oblivious about what happened.) , the &quot;deleted recent [questions/answers]&quot; links in one's own user profile now list all respective posts that were deleted in the past 60 days, rather than just those that were originally posted in the last 60 days. , users with the &quot;access to moderator tools&quot; privilege (10k+ on designed sites, 2k+ on beta and non-designed sites) can use the search operator deleted:1 to see all their own deleted posts. , deleted questions and answers that were posted in the past 60 days, can be seen using the &quot;deleted recent questions&quot; and &quot;deleted recent answers&quot; links on the questions and answers tabs (at the bottom of the tab) in your user profile. For older posts: as of 2013-04-23 you can if you already have a link to them, but they still aren't linked from the user profiles (not even just for you). Nor do you see inbox notifications for comments on them if you come back a few hours later. You have to have thought to bookmark your question, or you have to go digging for it in your browser history.", "I would like to add a new cable outlet to an outside wall and wanted to find out what kind of drill bit is needed to drill through and feed the coax cable as well as anything else to be mindful of. Comcast wanted $70 for a new outlet installation ($30 install, $40 tech visit), so I figured I could do it myself. The part that I'm most unfamiliar with is how to properly weather seal it. The outside just has vinyl siding and there's no electrical outlets nearby. So far, I think I need the following Coax Cable Coax Cable Wall Plate Long drill bit Add a 3-way Cable Splitter to cable box Weather sealer?", "Here is the top output which I gathered: I noticed that top is showing vlc's cpu usage is > 100%. Can anybody please justify me why it is showing like this, whether this is a bug in top application or something else.", "Is doing two PhDs a good path?", "Is Feyerabend confusing discovery and justification when he criticizes the scientific method? I am reading Feyerabend's \"Against Method\", where he uses Copernicus's (and Galileo's confirmation) discovery of the fact that the Earth orbits around the Sun and other examples to show that irrational approaches can lead to legitimate scientific progress. He then claims that no unified epistemic principle or principles can be used to define science, and that science is best characterized by anarchy. Is he confusing the way scientific truth is discovered with the way scientific truth is epistemically justified? Even if it is true that Copernicus, Galileo and others used irrational methods to arrive at valid scientific discoveries, why does that affect science's special epistemic status compared to other fields of inquiry?", "Question about Angle-Preserving Operators This an exercise out of Spivak's \"Calculus on Manifolds\". Edit: There was a typo in the exercise as is noted below in the answers. The statement has been edited to reflect this. Given $x,y\\in\\mathbb{R}^{n}$, the angle between $x$ and $y$ is defined by $$\\angle(x,y) = \\arccos\\left(\\frac{\\langle x,y \\rangle}{|x|\\cdot |y|}\\right),$$ where $\\langle x,y \\rangle$ denotes the standard Euclidean inner product. A linear operator $T:\\mathbb{R}^{n}\\to\\mathbb{R}^{n}$ is said to be angle-preserving if $\\angle(T(x),T(y)) = \\angle(x,y)$ for every $x,y\\in\\mathbb{R}^{n}$. The exercise as stated: Let $\\{x_{1},\\dots, x_{n}\\}$ be a basis for $\\mathbb{R}^{n}$. Then suppose that $\\lambda_{1}, \\dots, \\lambda_{n}\\in \\mathbb{R}$ are such that $Tx_{j} = \\lambda_{j}x_{j}$ for each $j = 1,\\dots, n$. Then $T$ is angle-preserving only if (not if and only if!)$|\\lambda_{i}| = |\\lambda_{j}|$ for every $1\\leq i\\leq j\\leq n$. I'm having problems with the $(\\Rightarrow)$ direction. My best attempt (which seems to lead nowhere) is to suppose that $|\\lambda_{j}|\\neq |\\lambda_{k}|$. Then by assumption, \\begin{align*} \\angle(Tx_{j},Tx_{k}) &amp; = \\arccos\\left(\\frac{\\langle Tx_{j},Tx_{k} \\rangle}{|Tx_{j}|\\cdot |Tx_{k}|}\\right)\\\\ &amp; = \\arccos\\left(\\frac{\\langle \\lambda_{j}{x_{j}},\\lambda_{k}{x_{k}} \\rangle}{|\\lambda_{j}{x_{j}}|\\cdot |\\lambda_{k}{x_{k}}|}\\right)\\\\ &amp; = \\arccos\\left(\\frac{\\lambda_{j}\\lambda_{k}\\langle {x_{j}},{x_{k}} \\rangle}{|\\lambda_{j}|\\cdot|\\lambda_{k}|\\cdot|{x_{j}}|\\cdot |{x_{k}}|}\\right)\\\\ &amp; = \\arccos\\left(\\text{sign}(\\lambda_{j})\\text{sign}(\\lambda_{k})\\frac{\\langle {x_{j}},{x_{k}} \\rangle }{|{x_{j}}|\\cdot |{x_{k}}|}\\right)\\\\ \\end{align*} may also be calculated as \\begin{align*} \\angle(Tx_{j},Tx_{k}) &amp; = \\angle(x_{j},x_{k})\\\\ &amp; = \\arccos\\left(\\frac{\\langle x_{j},x_{k} \\rangle}{|x_{j}|\\cdot |x_{k}|}\\right). \\end{align*} Then since $\\arccos$ is injective, I believe I can make the jump that $\\text{sign}(\\lambda_{j})\\text{sign}(\\lambda_{k}) = 1$, which does not resemble the conclusion that I should arrive at. Note: I wasn't sure what tag to put this under, so anyone who knows better please feel free to adjust. Thanks for any help you can give.", "Sorry if this is very basic but here's a question. Let $\\mathbf{v}=(v_1,\\ldots, v_n)\\in k^n$ where $k=\\bar{k}$. Why do we have $$ \\sqrt{\\sum_{i=1}^n |v_i|^2} \\leq \\sum_{i=1}^n |v_i|, $$ where the left-hand side can be thought of as the $2$-norm $\\|\\mathbf{v}\\|_2$ on $L^2(k^n)$? $\\mathbf{General \\; case}$: If this is true for $p=2$-norm, I am guessing that this is true for all $p\\geq 1$: $$ \\left( \\sum_{i=1}^n |v_i|^p\\right)^{1/p}\\leq \\sum_{i=1}^n |v_i|. $$ In fact, does this inequality hold when $p$ is a rational number?", "Override a method at instance level", "\"Arnold raced out of the door\": grammatical or not?", "Is there a PPA with the latest version of LibreOffice? There was recently another release of , but it is a pain to have to manually go to their website and download the packages every time there is a new release. Is there a PPA that always has the latest version of LibreOffice?", "Is it possible to be admitted to a masters in Germany with a 3-year bachelors from another country?", "Why haven't I received the \"Curious\" badge?" ]

[ "Analysis Question Involving Real Numbers", "The Boolean modifier is not working", "Range of values of skewness and kurtosis for normal distribution I want to know that what is the range of the values of skewness and kurtosis for which the data is considered to be normally distributed. I have read many arguments and mostly I got mixed up answers. Some says for skewness $(-1,1)$ and $(-2,2)$ for kurtosis is an acceptable range for being normally distributed. Some says $(-1.96,1.96)$ for skewness is an acceptable range. I found a detailed discussion here: regarding this issue. But I couldn't find any decisive statement. What is the basis for deciding such an interval? Is this a subjective choice? Or is there any mathematical explanation behind these intervals?", "How to use a special character as a normal one in Unix shells?", "What does it mean for something to hold \"up to isomorphism\"?", "What antivirus programs are available? What antivirus programs are available for Ubuntu? We previously used Symantec Endpoint Protection but it does not work in Ubuntu.", "Proof by Induction: For any integer $n > 0$, $3|(5^{2n} − 1)$. Is there any difference in proving \"for any integer $n &gt; 0$, $3|(5^{2n}-1)$\" and proving \"for any integer $n \\ge 0$, $3|(5^{2n} -1)$\"? Or are they the same?", "Interpretation of log transformed predictor and/or response", "Term or phrase describing action occuring when not watching", "Subsurf on a crown. How can I smooth some edges and keep others sharp? How can I smooth all crown but don't smooth the top of the crown? I did a subdivision surface, but this didn't work. All crown became smooth and changed form.", "How can I resize (not compress) multiple images in a MS Word document? In a blank document, I insert images (screenshots - all are of same size and same format) from a folder. I want to resize the images to a desired size. All now I am doing is selecting one image by one, setting its size. Word does not seem to have multiselect working for images. Ideally, I want to select multiple images set its size in one go with out use of a macro.", "Fundamental group of a torus with points removed Question 5.33 from \"Topology and its Applications\" by Baesner is to compute the fundamental group of the torus ($T^2$) with $n$ points removed. I can \"see\" in my mind that if we remove one point we get a bouquet of two circles. Less clear is what happens when we remove two (or more) points. Any hints?", "Writing comments in QGIS Graphical Modeler I want to explain my model step by step so anyone can easely understand what's going on. So, is it possible to write comments in the QGIS's Graphical Modeler?", "Is there consensus in the field of statistics that one book is the absolute best source and completely covering every aspect of GLM - detailing everything from estimation to inference?", "Is the use of a hyphen between \"non\" and an adjective strictly necessary? Do I need to put a \"-\" between \"non\" and an adjective? As an example in physics we say \"a non isolated photon\", \"non tight photon\"... The context is very formal (paper publications and similar). Is there a general rule? Are there some differences between countries?", "Missing settings in GNOME control center installed in Ubuntu MATE I installed GNOME Control Center following to access Google Drive in Ubuntu MATE 16.04 LTS (MATE desktop environment 1.12.1) The problem is GNOME Control Center is only showing language support, printers, firewall setup and backups... not online accounts or other settings. This is what I get: ~$ gnome-control-center gnome-online-accounts ** (gnome-control-center:5744): WARNING **: Ignoring launcher landscape-client-settings (missing desktop file) ** (gnome-control-center:5744): WARNING **: Invalid categories System;Settings; for panel software-properties-gtk.desktop ** (gnome-control-center:5744): WARNING **: Ignoring launcher ubuntuone-installer (missing desktop file) ** (gnome-control-center:5744): WARNING **: Could not find settings panel \"gnome-online-accounts\" Any ideas? Thanks!", "I have a directory with ~1M files and need to search for particular patterns. I know how to do it for all the files: find /path/ -exec grep -H -m 1 'pattern' \\{\\} \\; The full output is not desired (too slow). Several first hits are OK, so I tried to limit number of the lines: find /path/ -exec grep -H -m 1 'pattern' \\{\\} \\; | head -n 5 This results in 5 lines followed by find: `grep' terminated by signal 13 and find continues to work. This is well explained . I tried quit action: find /path/ -exec grep -H -m 1 'pattern' \\{\\} \\; -quit This outputs only the first match. Is it possible to limit find output with specific number of results (like providing an argument to quit similar to head -n)?", "Can helium disappear from Earth?", "This is meant to solve this problem once and for all. What is every reason an object isn't showing up in a render or viewport in when using the cycles render engine?", "I'm looking to cite a number of web pages using bibtex and I was wondering if there was a specific template of the form @&lt;template name here&gt; for doing that. If you could use the following website as an example that would be great" ]

[ "If a topology contains all infinite subsets, then it is the discrete topology I am solving question $8$ of exercises in section 1.1. of chapter 1 in \"Topology without tears\". The question reads as follows. Let $X$ be an infinite set and $\\tau$ be a topology on $X$. If every infinite subset of $X$ is in $\\tau$, prove that $\\tau$ is the discrete topology My idea was to show that every singleton set is in the topology and thereby the topology is discrete. Choose an infinite set $A$ from $X$ such that $A^c$ is also infinite. $A$ and $A^c$ belong to $\\tau$ since they are infinite sets. Now consider any $x \\in X$. Note that $A \\cup \\{x\\}$ and $A^c \\cup \\{x\\}$ belong to $\\tau$ since they are infinite sets. Hence, their intersection which is nothing but $\\{x\\} \\in \\tau$ for every $x \\in X$. The problem I have is I don't know how to prove the first sentence in the previous paragraph. These are my line of thoughts to prove them. If $X$ is a countably infinite set, then I can list the elements are let the odd numbered elements fall into $A$. This guarantees $A$ and $A^c$ are both infinite. If $X$ is uncountable, then I can choose a countably infinite subset and call it $A$. Are the above arguments rigorous? I am not especially happy with my second argument of choosing a countably infinite subset from an uncountable set since I do not give an explicit procedure of constructing the set $A$. Also, is there any other simpler way of answering the original question?", "Let $(a_n)_{n}\\in\\ell^2:=\\ell^2(\\mathbb{R})$ be a fixed sequence. Consider the subspace $$C=\\{(x_n)_{n}\\in\\ell^2 : |x_n|\\le a_n\\text{ for all }n\\in\\mathbb{N}\\}.$$ According to the book [Dunford and Schwartz, Linear operators part I, page 453] $C$ is compact in the $\\ell^2$-norm, but there is no proof. How can I show that $C$ is indeed compact in $\\ell^2$ ?", "How to delete kexts in Catalina? I have a 2014 MacBook Pro experiencing . Catalina does not allow kexts to be deleted via this method. Unless I am able to delete or disable this kext my laptop will shut down randomly. Anyone know how to remove kexts in Catalina?", "Built-in unit strings recognized by Quantity?", "A lot of people will probably gloss over this fact, but it looks like C-3PO meets BB-8 for the first time in this scene 0:20: But how does C-3PO know BB-8's name? Is there a time where C-3PO meets BB-8 before this and knows his name?", "Do lenses have focal planes or focal spheres/ellipsoids?", "How can I use variables in the LHS and RHS of a sed substitution?", "How is memory allocated for an implicitly defined multidimensional array in C99?", "Print escaped representation of a str", "How do I disable the guest session in Ubuntu 11.10 or higher? I don't want people to be able to use my computer without using a password to log in!", "Displaying page construction guides Is there any way to overlay some lines and dimensions on the document so that one can see where the margins end and more easily examine the overall layout and ratios of elements on the page? See for example, some of the illustrations of frameworks in this article on the and this one on (which displays dimensions).", "How do we \"restore\" notepad after crash? I was running NotePad and Chrome when my computer suddenly shuts down. After reboot, chrome was able to \"restore\" itself such that I didn't lose any data. However, how do we \"restore\" notepad.exe?", "'Should've seen it glow' or 'should've seen it glowing'? Which one of the following is the correct one? I should have seen it glow. I should have seen it glowing. Or are both correct? Would you parse them please?", "When would you use the Builder Pattern? What are some common, real world examples of using the Builder Pattern? What does it buy you? Why not just use a Factory Pattern?", "Why isn't $V= V_1 + V_2$? $V=V_a - V_c = V_a - V_b + V_b - V_c$, $V_a - V_b= V_1$ and $V_b - V_c = V_2$ Doesn't that prove that $V = V_1 + V_2$? Regardless of $V_3$, If i'm wrong , is there a way to obtain $V$ in terms of $V_1$, $V_2$ and $V_3$", "I don't know which buttons I have to click or what key combination to type to calculate a cube root.", "Reset post score to 0 on migration I suggest that when a post is migrated from one site to another, that the question vote score get reset to zero (or perhaps only a negative vote score is reset to zero). Often people will downvote a question when the only thing that's \"wrong\" with it is that it's posted on the incorrect site. After migration, those downvotes hang around as a negative score and may unfairly bias the treatment of the question.", "There is a being thrown out of a flask, literally hovering out of the container My question is how detailed a physical explanation of this phenomenon we have? Question: More precisely, if we used the best available mechanical physics simulator software, and we tried to simulate this behavior, would the software be able to reproduce the effect or not? My guess is not but I would like to know why not. Or do we have to content ourselves only with handwaved explanations? I am from the school of thought that you don't understand physics until you have a reasonable certainty that you can reproduce the physics in a computer.", "What are the advantages of a custom ROM over rooted stock?", "Can a set be neither open nor closed? An example would do. I cant think of any. Thanks in advance!" ]

[ "Rings' second isomorphism theorem I am thinking about the proof of the second isomorphism theorem, and something isn't very clear to me. Let $R$ be a ring, $S\\subset R$ a subring and $I\\subset R$ an ideal. We have the natural homomorphism $f:R\\rightarrow R/I$. The theorem states that $\\mathrm{Im}(S)=(S+I)/I$. My question is why not simply $\\mathrm{Im}(S)=S/I$? I understand that it is not true (for starters, $S/I$ need not be a subring), but I cannot explain that to my self in a convincing way.", "Does the sign of scores or of loadings in PCA or FA have a meaning? May I reverse the sign?", "What is the relation between electromagnetic wave and photon? At the end of this nice video (), she says that is a chain reaction of electric and magnetic fields creating each other so the chain of wave moves forward. I wonder where the is in this explanation. What is the relation between electromagnetic wave and photon?", "How much willpower do gravely wounded soldiers lose? The text says they suffer a permanent reduction?", "Could humans choose to establish fibre digesting colonies in our guts? Humans don't digest fibre, and nor do any animals, but some creatures have micro-organisms (bacteria, I'm guessing) in their gut which digest fibre for them. My question is, could humans take some sort of pill and establish our own fibre-digesting colonies in our intestines? Has this been tried? Supposing it could be done, would you suppose it would have any negative effects on our health? (i.e.. would those whose gut digested fibre for them be stuck on a low-fibre diet?). Purpose of question: just wondering. It would be cool to be able to eat bark.", "When should I use \"when\" and \"while\"? But you can't find anything while you're crying. But you can't find anything when you're crying. I'll tell you about it while Frank saddles the horse. I'll tell you about it when Frank saddles the horse. When should I use when, and when while? Are these sentences correct?", "We are Indian passport holders, with valid visas for Canada. Plan is to take the EgyptAir flight Mumbai to Toronto, via Cairo. Problem is Egypt embassy website says we don't need Transit Visa if transit is up to 12 hours but here transit is 14 hours. Has anyone with a Indian passport traveled this route? What was your experience at Cairo? Did you need a transit visa?", "Syntax highlighting language hints Do you think it would be worthwhile to provide hints as to what language to use for the syntax highlighting? Sometimes I find the highlighting on SQL or VB.NET answers is more distracting than helpful; for example: to pick the two I've been looking at recently.", "What is this element on the far right of schematic described as \"270 OHM\"? Is this some kind of inductor? What is its purpose in this device (this is a reference design of dc-dc power supply of sim900 taken from its datasheet) and what would be an exemplary part number?", "Change \\textwidth and \\textheight in mid-document I set my \\textwidth and \\textheight in the preamble and would like to change both for some pages. How can this be done? E.g., the following example for \\textwidth appears to work for the page number, but not for the text: \\documentclass{article} \\textwidth=5cm \\textheight=5cm \\begin{document} A \\hfill B \\eject \\textwidth=10cm A \\hfill B \\end{document} Output (true to scale):", "Including sections of source code as a listing, while being robust to source code edits", "\"This is a favorite question\" tooltip when not favorite", "I'm working in C, and I have to concatenate a few things. Right now I have this: message = strcat(\"TEXT \", var); message2 = strcat(strcat(\"TEXT \", foo), strcat(\" TEXT \", bar)); Now if you have experience in C I'm sure you realize that this gives you a segmentation fault when you try to run it. So how do I work around that?", "To put it simple, there's a simple java swing app that consists of JFrame with some components in it. One of the components is a JPanel that is meant to be replaced by another JPanel on user action. So, what's the correct way of doing such a thing? I've tried panel = new CustomJPanelWithComponentsOnIt(); parentFrameJPanelBelongsTo.pack(); but this won't work. What would you suggest?", "Anyone know of a custom GPS ROM for Samsung Galaxy 5? Possible Duplicate: I recently bought a Samsung Galaxy 5 (model number GT-I5500) and I'm new to the android world. I'm not satisfied with the performance of the GPS on my cell phone so I thought it would be interesting to use a custom ROM to see if it improves a bit. Anyone knows of a ROM that was tested in this model?", "Deciphering the RSA encrypted message from three different public keys I have three different 1024-bit public keys with common exponent $e$ but different moduli. A message $m$ is encrypted (without padding) using the three keys, which results in three different encrypted messages. Given the three pairs of public keys $(N_i,e)$ and the encrypted messages $c_i=m^e\\bmod N_i$ , how do I decipher the original message $m$ ?", "I'm having issues with my macbook pro OS X 10.7.5. It used to connect to the wifi router (D-Link N300, DIR=615) no problems. But for the past several weeks, I haven't been able to at all. What pops up when I select my wifi network from the list: \"Failed to join \"network\" A connection timeout occured\". What happens when I try to enter my password manually: \"Connection timeout\" What I've tried to do as solutions: Google Restart router by pressing reset &amp; refresh button Delete System &amp; User (Login) Keychain access Network > Gear symbol by the + and - bottom left of the screen > Set Service Order > Drag Wifi to the top", "I have heard a few times that one way of describing quantum computers is that they essentially use the computing power of their counterparts in alternate realities that they access through superposition. My first question is, of course, is this actually an accurate description of how quantum computers work, or just a misrepresentation? Also, if it were to be assumed true and taken literally, then presumably all the possible outcomes of any given computation done would be experienced by each of these alternate realities. I have a few questions regarding the implications of this: Would it be correct to say that our universe essentially \"spawns\" these alternate realities to use for each computation, or that they all exist simultaneously in a higher dimension and only come into contact via the initiation of superposition by each computer at the same time? Would it be possible to create contact between universes via this connection? I'd expect that, if it was, it would be entirely random, and so not only would not cause any information transfer, it also would be completely undetectable, because the deviations would be within the expected probabilities of error rates - but is there any way to circumvent this?", "Root cause for \"Entity is not org-accessible\" for sharing object?", "How would one denote the set of all subsets of $A$ which have size $2$? Would $$\\binom{A}{2}$$ be a good idea?" ]

[ "How are percentiles calculated in Careers 2.0? I noticed that a percentile is placed at the top of my resume in Careers 2.0. How are these percentiles calculated? Is there a certain threshold you need to be over in order for it to be displayed?", "Tabs in output file written by xelatex and pdflatex are different", "We have a situation: someone saw the boy break the window. Can I make this passive sentence? The boy was seen to break the window. I use Murphy's Grammar and this structure is never discussed.", "I have a bibliography in which a particular author wrote two papers in the same year. Bibtex is sorting them alphabetically by title, but I want them listed chronologically. (So in the example below 'universal grammar' should precede 'English as a formal language'.) What's the appropriate way to flip the order? MWE: \\documentclass{article} \\usepackage{natbib} \\begin{document} ... formal semantics in the Montagovian tradition \\citep{montague1970aug,montague1970befl,montague1973ptq}. \\bibliographystyle{harvard} \\bibliography{test} \\end{document} This generates the text 'formal semantics in the Montagovian tradition (Montague, 1970b,a, 1973)' whereas I actually want '1970a,b,1973'. test.bib file for MWE: @incollection{montague1973ptq, title={The proper treatment of quantification in ordinary {English}}, author={Montague, Richard}, booktitle={Approaches to natural language}, editor={Hintikka, K. Jaakko J. and Moravcsik, Julius M.E. and Suppes, Patrick}, pages={221--242}, year={1973}, publisher={Dordrecht} } @article{montague1970aug, title={Universal grammar}, author={Montague, Richard}, journal={Theoria}, volume={36}, number={3}, pages={373--398}, year={1970}, publisher={Blackwell Synergy} } @incollection{montague1970befl, title={English as a formal language}, author={Montague, Richard}, booktitle={Linguaggi nella Societa e nella Tecnica}, editor={Visentini, Bruno and others}, publisher={Edizioni di Comunità}, pages={189--224}, year={1970} }", "Provide an easily discoverable way to get the full URL to an answer , clicking &quot;link&quot; &quot;share&quot; for anwers yields a short (traceable) URL in the &quot;share a link to this answer&quot; dialog, such as †: These short URLs show no clue about the linked question whatsoever. Also, when different people use a short URL for the very same post, then the user id suffix makes those be different URLs for a browser. Such links will then not be shown as visited‡. I know how to get URLs that have a proper slug. But as I see pop up on these sites (where referrals ), I assume many others just don't realize full URLs would be better for use on these sites themselves? Or many don't want to do the little effort to get the full URL? So: can we please have an easy way to get the full URL as well, in a way that is easily found for those who don't know about the different links? (Currently for questions, clicking &quot;link&quot; has the same effect. But then one can also right-click the title, or take the URL from the location bar, to get the full human-readable URL. Once, Jeff .) † The short links for answers are not (yet) [automatically converted][6] into a clickable question title either, unlike links such as `https://meta.stackexchange.com/questions/74274/privacy-leak-in-permalink#75963`, which renders as https://meta.stackexchange.com/questions/74274/privacy-leak-in-permalink#75963 But I guess that will change soon. ‡ On Meta the CSS for posts doesn't indicate such difference anyway, which is a different issue.", "How to style text in hyperref \\url? I want to set color, font and similar style attributes for the text in a \\url from the hyperref package. How do I go about doing it? All I have found are . I want to because I am using ttf fonts for my texts and I want my urls to be in that ttf and not the default (typewriter font?) that the hyperref package gives me. I started with just trying to get it in italics but didn't even succeed with that: \\documentclass{memoir} \\usepackage{hyperref} \\begin{document} Lala \\url{\\itshape www.example.com}. \\end{document} I am guessing there is some hook or something but I just can't find it. Maybe I have gone blind?", "Uniform Scattering with vector I'm attempting to create a random spread of dots to create a gradient look. I'm getting really close to the effect I want by blending two scatter brushes. The issue I'm having is that the blended brushes creates unwanted lines, and the dots run into each other. I keep adjusting the settings with no luck. Here's the effect I'm wanting to achieved. Smooth transition On Circular path Dots don't converge Scattered at random-ish Here's how close I'm able to get: Blended scatters create unwanted lines Dots converge Spacing isn't gradual from edge to center", "Displaying world country shapefiles centered on Pacific Ocean using Robinson or Miller Cylindrical projection in QGIS? I wish to display a map in QGIS (world country shapefiles) showing all countries but centered on the Pacific area. I am not familiar with Proj4, so is there any way this can be done in QGIS?", "Nautilus not generating thumbnails in 13.10 Like the title says, Nautilus is not generating thumbnails for any file types (pictures, documents, pdf, etc) after a clean install of 13.10. I have checked the preferences and it is set to always generate thumbnails. Help please!", "How to print the longest line in a file? I'm looking for the simplest method to print the longest line in a file. I did some googling and surprisingly couldn't seem to find an answer. I frequently print the length of the longest line in a file, but I don't know how to actually print the longest line. Can anyone provide a solution to print the longest line in a file? Thanks in advance.", "Uniform convergence for sequences of functions", "Does editing still bump a question? Many times in the past I've edited a somewhat recent answer—say, from 30 minutes ago—and noticed that the concomitant question didn't bump to the top. I just confirmed it with ; the question is currently sorted in the JavaScript page based on when it was asked, not my edit. I've never made edits just to bump a question to whore rep—my original answer was wrong which was why I fixed it—but my understanding is that the CW self-edit trigger exists to prevent edit-then-bump-then-score-rep—profit! activity. If non-ancient edits no longer bump a question, should the self-edit CW trigger be brought inline with this? Should an answer be made CW if you make 10 edits that actually bump the question? and to avoid any implication of impropriety, I'm already capped on SO, so I'm not looking for any sort of \"meta effect\" on my answer", "Let $(a_n)_{n}\\in\\ell^2:=\\ell^2(\\mathbb{R})$ be a fixed sequence. Consider the subspace $$C=\\{(x_n)_{n}\\in\\ell^2 : |x_n|\\le a_n\\text{ for all }n\\in\\mathbb{N}\\}.$$ According to the book [Dunford and Schwartz, Linear operators part I, page 453] $C$ is compact in the $\\ell^2$-norm, but there is no proof. How can I show that $C$ is indeed compact in $\\ell^2$ ?", "induction proof: $\\sum_{k=1}^nk^2 = \\frac{n(n+1)(2n+1)}{6}$ I encountered the following induction proof on a practice exam for calculus: $$\\sum_{k=1}^nk^2 = \\frac{n(n+1)(2n+1)}{6}$$ I have to prove this statement with induction. Can anyone please help me with this proof?", "What the difference is here? Are you seeing ? VS Do you see? Are you seening family members arriving at the hospital to find some of the miners? ( exact quote from BBC presenter asking someone over the phone ) Do you see ....... Difference in meaning not grammar.", "Copy every 512 bytes and skip next 8 bytes from Input file to a Output file I have an input file which is always a multiple of 520 bytes . i,e Input file 1- 1040 bytes Input file 2- 5200 bytes I need to copy every 512 bytes from input file and skip the next 8 bytes from input files to output file i.e Output file data = Copy first 512 bytes of input file - Skip 8 bytes - Copy second 512 bytes of input file- Skip 8 bytes --.. Therefore, my output file should always be multiple of 512 bytes Input file 1- 1040 bytes Output file 1 - 1024 bytes Input file 2- 5200 bytes Output file 2 - 5120 bytes I need to do this in shell script, any help here please.", "Is it possible to create a URL link to a website on the home screen?", "How to make overlay still work inside lstlisting environment? Problem I want to explain C# programming language step by step using overlay in beamer.cls. But it does NOT works as shown in the following figure. How to solve this problem? Code Snippet \\documentclass[dvipsnames,cmyk]{beamer} \\usepackage{listings} \\begin{document} \\defverbatim[colored]\\Lst{% \\begin{lstlisting}[language={[Sharp]C}] using System; public delegate void Foo(object o); \\uncover&lt;1&gt;{public class Foo} \\uncover&lt;2&gt;{\\{} \\uncover&lt;3&gt;{public static void Main()} \\end{lstlisting}} \\begin{frame}{MyListing} \\Lst \\end{frame} \\end{document}", "Transit Visa in Hong Kong for 15 hour layover between India and USA? We are (2) Indian nation and travelling from India to USA via Hong Kong airport and about 15 hours layover in Hong Kong airport. Do we need a transit visa even if only changing planes? And can we apply in Hong Kong Airport?", "How to show that $f_{0}f_{1}+f_{1}f_{2}+...+f_{2n-1}f_{2n} = f^{2}_{2n}$ The following problem: The Fibonacci number is denoted by $f_{n}$, show that the following holds when $n$ is a positive integer: $f_{0}f_{1}+f_{1}f_{2}+...+f_{2n-1}f_{2n} = f^{2}_{2n}$ My idea was to do an induction proof, which holds for $n$ = 1 $f_{0}f_{1} + f_{1}f_{2} = f^{2}_{2}$ So we assume it holds for $n$ and show for $n+1$ $f_{0}f_{1}+f_{1}f_{2}+...+f_{2n-1}f_{2n} + f_{2n}f_{2n+1} = f^{2}_{2n} + f_{2n}f_{2n+1}$ I fail to get $f^{2}_{2n+1}$ out of the term $f^{2}_{2n} + f_{2n}f_{2n+1}$ Is there a difference between \"show that\" and \"prove that\". So might be induction the wrong tool here? Many thanks for your hints in advance :-)" ]

[ "I have the following code: if ($_POST['submit'] == \"Next\") { foreach($_POST['info'] as $key =&gt; $value) { echo $value; } } How do I get the foreach function to start from the 2nd key in the array?", "I am working on a Drupal mulsite project (using single database) and using Google Analytics module for this. I have follow the below steps for GA configuration: Created a domain name example1.com and a sub-domain name example2.com. Create an account on GA and create property for both of this domain name in GA account. Both property give me two different Tracking ID (same as below screenshot). Into the configuration setting of GA from drupal admin section I have added Web Property ID of example1.com and into domain setting added both the domain name example1.com and example2.com into the section of List of top-level domains (a same as attached screenshot). Now this configuration is only working for emample1.com, not for example2.com. So can anyone please tell me how can I use Web Property ID of domain exmaple2.php to get the result?", "Does Qt have a C interface?", "is there an easy way or photoshop plugin to distribute words in evenly spaced formation", "How to calculate time difference in java?", "In classic OLS regression it is well-known that $(\\mathbf{I}-\\mathbf{H})\\mathbf{y}=\\mathbf{r}$, where $\\mathbf{I}$ is the identity matrix, $\\mathbf{H}$ is the , $\\mathbf{y}$ is the vector of response (dependent) values, and $\\mathbf{r}$ is the vector of residuals. My question is whether the scalar $\\mathbf{y}^T(\\mathbf{I}-\\mathbf{H})\\mathbf{y}=\\mathbf{y}^T\\mathbf{r}=\\mathbf{y}^T\\mathbf{y}-\\mathbf{y}^T\\mathbf{\\hat{y}}$ has some meaningful interpretation.", "I am very new to the TikZ package, and I need to draw some flow chars by using the following shapes. However I couldn't figure out how to draw the 4th and and 6th ones below. It would be very nice (for completeness) to help with all of the shapes in the list below. Your help will be greatly appreciated. Note: I have visited but it contains some other shapes.", "What are some good tips on how to extrude text in Adobe Illustrator? I'm bit of a newbie in Adobe Illustrator and have been learning the application by trying to follow some tutorials and recreating some cool stuff I come across on the web. That being said, I'm having trouble replicating the effect found in the following image using the standard 'Extrude &amp; Bevel' options. I've also tried copying + pasting the text in front, back, in place and that came out even more horrendous. 'Extrude &amp; Bevel' gives me a nice approximation but nothing that pops out like in the example. Any tips on how to fine tune my 'Extrude &amp; Bevel' settings or an entirely different method of achieving a similar effect would be very much appreciated. Thanks for your time and help! How can I create a 3D effect on my text similar to the one in the following image, using Illustrator's Extrude and Bevel tools?", "Is it possible to switch from one area of graduate study to another in US universities? For example, suppose someone has enrolled in a computer science phd program. Can he switch over to math(or physics) phd program in the same school later?(or say from applied mathematics to pure mathematics?) What are the steps for doing for doing that?", "How to enable touchpad? Yesterday, suddenly my touchpad on my MSI Laptop started to not respond. In other words, in Login screen, touchpad is working as expected. However, in Desktop screen, after I have logged in, touchpad is not working. How can I enable touchpad in Desktop?", "What is the difference between \"getting robbed\" and \"getting mugged\"? I can't seem to find the difference on the internet between \"getting robbed\" and \"getting mugged\". I would appreciate it if you could explain it to me.", "What is the meaning of speed of light $c$ in $E=mc^2$? is the famous mass-energy equation of Albert Einstein. I know that it tells that mass can be converted to energy and vice versa. I know that $E$ is energy, $m$ is mass of a matter and $c$ is speed of light in vacuum. What I didn't understood is how we will introduce speed of light? Atom bomb is made using this principle which converts mass into energy; in that the mass is provided by uranium but where did speed of light comes into play? How can speed of light can be introduced in atom bomb?", "Proving an inequality involving the logarithm function: $\\frac{1}{n+1} \\leq \\ln \\left(1+\\frac 1n\\right) \\leq \\frac 1n$ The question is to prove the inequality $$\\frac{1}{n+1} \\leq \\ln \\left(1+\\frac 1n\\right) \\leq \\frac 1n\\\\\\forall n \\geq 1, n\\in \\mathbb N$$ I tried using Taylor expansion but couldn't figure out anything. Any ideas? Thanks.", "Windows Logs Application is full of \"Login failed for user 'sa'. Reason: Password did not match that for the login provided. [CLIENT: ****]\" I have Windows Server 2016, with SQL Server 2017, and found Windows Log Application is full of Login failed messages (as follows) : Login failed for user 'sa'. Reason: Password did not match that for the login provided. [CLIENT: ****] Client's IP addresses are various. I don't have any maintenance plan in SQL Server What's the problem?", "Intuitive idea of the Lipschitz function I'm trying to understand intuitively the notion of Lipschitz function. I can't understand why bounded function doesn't imply Lipschitz function. I need a counterexample or an intuitive idea to clarify my notion of Lipschitz function. I need help Thanks a lot", "The help pages in R assume I know what those numbers mean, but I don't. I'm trying to really intuitively understand every number here. I will just post the output and comment on what I found out. There might (will) be mistakes, as I'll just write what I assume. Mainly I'd like to know what the t-value in the coefficients mean, and why they print the residual standard error. Call: lm(formula = iris$Sepal.Width ~ iris$Petal.Width) Residuals: Min 1Q Median 3Q Max -1.09907 -0.23626 -0.01064 0.23345 1.17532 This is a 5-point-summary of the residuals (their mean is always 0, right?). The numbers can be used (I'm guessing here) to quickly see if there are any big outliers. Also you can already see it here if the residuals are far from normally distributed (they should be normally distributed). Coefficients: Estimate Std. Error t value Pr(&gt;|t|) (Intercept) 3.30843 0.06210 53.278 &lt; 2e-16 *** iris$Petal.Width -0.20936 0.04374 -4.786 4.07e-06 *** --- Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1 Estimates $\\hat{\\beta_i}$, computed by least squares regression. Also, the standard error is $\\sigma_{\\beta_i}$. I'd like to know how this is calculated. I have no idea where the t-value and the corresponding p-value come from. I know $\\hat{\\beta}$ should be normal distributed, but how is the t-value calculated? Residual standard error: 0.407 on 148 degrees of freedom $\\sqrt{ \\frac{1}{n-p} \\epsilon^T\\epsilon }$, I guess. But why do we calculate that, and what does it tell us? Multiple R-squared: 0.134, Adjusted R-squared: 0.1282 $ R^2 = \\frac{s_\\hat{y}^2}{s_y^2} $, which is $ \\frac{\\sum_{i=1}^n (\\hat{y_i}-\\bar{y})^2}{\\sum_{i=1}^n (y_i-\\bar{y})^2} $. The ratio is close to 1 if the points lie on a straight line, and 0 if they are random. What is the adjusted R-squared? F-statistic: 22.91 on 1 and 148 DF, p-value: 4.073e-06 F and p for the whole model, not only for single $\\beta_i$s as previous. The F value is $ \\frac{s^2_{\\hat{y}}}{\\sum\\epsilon_i} $. The bigger it grows, the more unlikely it is that the $\\beta$'s do not have any effect at all.", "How to make `cd dir/filename` take me to dir/? I would find it very convenient to be able to use cd with a file argument. cd myDirectory/anyname.anyExtension would be equivalent to cd myDirectory/ What would be the best alias or function to achieve this behavior ? EDIT: Sorry I didn't mention it in the 1st place: I use zsh", "Before: After: The pros: Speeds up the tag synonym voting process. Easier to locate (as opposed to navigating to each individual tag wiki page). Encourages users to vote on more than one at a time. The cons: Serial up/downvoting. But this really isn't even an issue because, (1) only experienced users can vote on tag synonyms, and (2) more than one vote is required to approve a tag synonym, so the occasional serial up/downvoter won't significantly impact the overall process.", "TRON: Game A.I algorithm?", "Why do I see a double variable initialized to some value like 21.4 as 21.399999618530273?" ]

[ "Generating x,y coordinates for an edge detection of image", "Setting Access-Control-Allow-Origin in ASP.Net MVC - simplest possible method", "Will using 'var' affect performance?", "I have two large external drives with about 2.5 TB of data. About half the storage is images and videos that I want to put on a new NAS drive/device. I don’t want to carry over junk, duplicates and non photo/video files. I am hoping Lightroom can help scour the mounds of folder structures on these drives and copy images/videos the new drive that I want to catalogue and keep clean as a working platform for all images and video. Once completed I plan to format the original drives and copy the cleaned-up content back to them as part of a backup strategy. Can Lightroom help? If so, how? If not, is there some other application for Mac OS X that I can use for help with this? One problem I had with my original attempt is I wasn't sure how to move images and rename folders to get the new drive contents to make sense, so I formatted it and am looking to try again. (steps for this operation would be helpful)", "Find the limit: $\\displaystyle\\lim_{x\\to \\infty} (\\sqrt{x^2+x}-\\sqrt{x^2-x})$.", "What is a good asymptotic for $f_n = f_{n-1}+\\ln(f_{n-1})$?", "Towards the end of , it's revealed that Borden accomplishes his Transported Man trick by using his twin brother, Fallon, as a double. It then becomes clear that he has been doing this in his personal life as well as on stage - each brother leads 'half a life', sometimes appearing as Borden and sometimes as Fallon. This is how he completes the illusion: one Borden goes into the first door, the other Borden emerges from the second door a moment later. Angier doesn't know how Borden does the trick, and doesn't believe Borden uses a double despite being told as much by Cutter. He follows what he believes to be a clue in Borden's notebook and travels to Colorado to meet Nikola Tesla, who Angier believes can build a machine that can help him perform the trick. Angier believes that Tesla built a similar machine for Borden. However, the final pages of the notebook reveal that Tesla was merely a red herring, designed to get Angier out of Borden's way for a long time. Tesla, it turns out, had never built such a machine before. At this point, Tesla agrees to build Angier's machine anyway. Instead of building a machine that transports matter, he builds one that duplicates it. Angier uses this machine in his act, but in order to avoid having to deal with multiple clones (the &quot;prestige materials&quot;), one of them must die as part of the act. This all makes sense, so far, but I find it hard to believe that Borden's use of the word 'Tesla' as the key to his cipher is random. It's too coincidental that he sends Angier on a wild goose chase, but Angier returns with a working machine. A film that is otherwise so tightly plotted shouldn't rely on coincidence to move the narrative forward, so there must be something else going on. Is it possible that Borden cloned himself using Tesla's machine?", "What is the difference between the | and || or operators? I have always used || (two pipes) in OR expressions, both in C# and PHP. Occasionally I see a single pipe used: |. What is the difference between those two usages? Are there any caveats when using one over the other or are they interchangeable?", "In a few large projects i have been working on lately it seems to become increasingly important to choose one or the other (XML or Annotation). As projects grow, consistency is very important for maintainability. My questions are: what are the advantages of XML-based configuration over Annotation-based configuration and what are the advantages of Annotation-based configuration over XML-based configuration?", "I need to cast single figures (1 to 9) to (01 to 09). I can think of a way but its big and ugly and cumbersome. I'm sure there must be some concise way. Any Suggestions", "British Airways (BA) just changed our flight times, leaving us only 1h15mins for our layover in Heathrow. We arrive from Brussels in terminal 5 in Heathrow at 7:55 and our next flight leaves for Miami in Heathrow terminal 3 at 9:10. This seems awfully short. Does anyone know whether this is doable? The flights are in November, so I'm still hoping that the flights will change back to the original flight times, which would give us an additional hour for the layover, but in case this does not happen, what are the chances that we will make the connecting flight in 1h15mins?", "What did the public at large know about the assassination attempt on Palpatine and how he survived it?", "The sum of powers of two and two's complement – is there a deeper meaning behind this?", "Game State 'Stack'? I was thinking about how to implement game states into my game. The main things I want for it are: Semi-transparent top states-being able to see through a pause menu to the game behind Something OO-I find this easier to use and understand the theory behind, as well as keeping orgranised and adding more to. I was planning on using a linked list, and treat it as a stack. This means I could access the state below for the semi-transparency. Plan: Have the state stack be a linked list of pointers to IGameStates. The top state handles its own update and input commands, and then has a member isTransparent to decide whether the state underneath should be drawn. Then I could do: states.push_back(new MainMenuState()); states.push_back(new OptionsMenuState()); states.pop_front(); To represent the player loading, then going to options, and then main menu. Is this a good idea, or...? Should I look at something else? Thanks.", "Looking for a single word for 'blind worship' Is there a single word for 'blind worship' as in worshiping an actor blindly notwithstanding the bad performance?", "I have a batch file which I use to create an .apk file on my Windows machine. Now I need to be able to create the .apk file in Ubuntu but I don't know how translate my .bat file to a script to be able to run it on Ubuntu. Below is the batch file which works fine on Windows. Will you please give me some hints on how I can run it on Ubuntu? @echo off set PAUSE_ERRORS=0 :user_configuration :: Path to Flex SDK set FLEX_SDK=C:\\sdk\\flex_sdk_4.5.1.21328 :: Path to Android SDK set ANDROID_SDK=C:\\sdk\\android :validation if not exist \"%FLEX_SDK%\\bin\" goto flexsdk if not exist \"%ANDROID_SDK%\\platform-tools\" goto androidsdk goto succeed :validation if not exist \"%FLEX_SDK%\\bin\" goto flexsdk if not exist \"%ANDROID_SDK%\\platform-tools\" goto androidsdk goto succeed :flexsdk echo. echo ERROR: incorrect path to Flex SDK echo. if %PAUSE_ERRORS%==1 pause exit :androidsdk echo. echo ERROR: incorrect path to Android SDK in 'bat\\SetupSDK.bat' echo. if %PAUSE_ERRORS%==1 pause exit :succeed set PATH=%PATH%;%FLEX_SDK%\\bin set PATH=%PATH%;%ANDROID_SDK%\\platform-tools :: Android packaging set AND_CERT_NAME=\"PeymanApp\" set AND_CERT_PASS=fd set AND_CERT_FILE=cert\\SampleApp.p12 set AND_ICONS=icons/android set AND_SIGNING_OPTIONS=-storetype pkcs12 -keystore \"%AND_CERT_FILE%\" -storepass %AND_CERT_PASS% :: Application descriptor set APP_XML=application.xml :: Files to package set APP_DIR=bin set FILE_OR_DIR=-C %APP_DIR% . :: Your application ID (must match &lt;id&gt; of Application descriptor) set APP_ID=air.com.doitflash.SampleApp :: Output packages set DIST_PATH=dist set DIST_NAME=PeymanApp :validation %SystemRoot%\\System32\\find /C \"&lt;id&gt;%APP_ID%&lt;/id&gt;\" \"%APP_XML%\" &gt; NUL if errorlevel 1 goto badid goto end_validation :badid echo. echo ERROR: Application ID (APP_ID) does NOT match Application descriptor '%APP_XML%' (id) echo. :end_validation set TARGET= set PLATFORM=android ::call bat\\Packager.bat if \"%PLATFORM%\"==\"android\" goto android-config :android-config set CERT_FILE=%AND_CERT_FILE% set SIGNING_OPTIONS=%AND_SIGNING_OPTIONS% set ICONS=%AND_ICONS% set DIST_EXT=apk set TYPE=apk goto start :start if not exist \"%CERT_FILE%\" goto certificate :: Output file set FILE_OR_DIR=%FILE_OR_DIR% -C \"%ICONS%\" . if not exist \"%DIST_PATH%\" md \"%DIST_PATH%\" set OUTPUT=%DIST_PATH%\\%DIST_NAME%%TARGET%.%DIST_EXT% :: Package echo true echo. call adt -package -target %TYPE%%TARGET% %OPTIONS% %SIGNING_OPTIONS% \"%OUTPUT%\" \"%APP_XML%\" %FILE_OR_DIR% -extdir lib/ echo. if errorlevel 1 goto failed goto end :certificate echo Certificate not found: %CERT_FILE% echo. if %PAUSE_ERRORS%==1 pause exit :failed echo APK setup creation FAILED. if %PAUSE_ERRORS%==1 pause exit :end", "Why do Oreo crumbs float to a single glob at the very center in a glass of milk? I had Oreos and milk a while ago and left my half-full cup of milk out on the counter. Afterwards I noticed that the crumbs had surfaced in a circular coin-sized glob, and just now I looked again to see all of the crumbs seem to have compressed into a more dense glob at the very center of the cup. Why does this happen?", "What does it mean that GUIkit is being deprecated?", "A function $f: \\mathbb R \\to \\mathbb R$ satisfies equation $f(x+y)=f(x)f(y)$ for all $x,y\\in \\mathbb R $", "For Christmas my kiddo got the D&amp;D Starter Set and we've been going though it and the full rules we downloaded online. I'm having a hard time figuring out how the example listed in the rules gets to a final value of 14. The example is a level 1 character with wisdom of 15 and a proficiency in perception. I understand that you start with 10 (base) + 2 (character level) + 2 (wisdom 15) which gets you to 14 but then how does the \"proficiency in perception\" help or factor in? What gets more confusing is on one of the pre-generated character sheets has a level 1 character with wisdom of 10 but a passive perception value of 10. If I follow the math from above shouldn't it be 10 (base) + 2 (char lev 1) + 0 (wisdom 10 = 0 bonus) for a final score of 12? How to calculate passive perception?" ]

[ "How do I split a string, breaking at a particular character?", "Let's make the hot network questions icons clickable I would like to see the icons in the 'Hot Network Questions' right panel clickable, leading to the homepage of the site where the question comes from. It would make it more comfortable to switch to the site when you want rather to visit it than to see that specific \"hot\" question.", "What are the correct settings for min-memory and max-memory in this use case? The server has 8GB ram, dual Intel Xeon processors, running Windows Server 2008 R2 / Sql Server 2008 Standard Edition. It's running several databases ranging from 30GB - 5GB in size. Originally the memory usage was set to the default settings (min=0 max=2,147,483,647). On these settings most of the memory usage was taken up by sqlservr.exe and the server would eventually need to be restarted every day or two. It would run normally at first but within a day start to timeout on simple operations like looking up a record using the primary key. I have changed min=4,096 and max=6,144. This results in only 1.4GB memory usage. However now all four cpus are running at 50-60% cpu usage constantly. Tasks are taking roughly 1/3rd longer to execute, although the server is much more stable.", "Finding distance between consecutive points using ArcGIS Desktop?", "Next badge select dialog broken The \"Select your next badge\" dialog box is not displaying correctly. It looks like this: Freehand circles, as requested: It seems to be an issue with box-sizing, because when it's content-box, it looks fine. I think the width and height rules for .popup-badges .all-badge-progress .badge-progress should be increased a little, for example: .popup-badges .all-badge-progress .badge-progress { width: 214px; height: 96px; } Tested on the latest Chrome and Firefox on Linux Mint.", "In Monopoly, Is it OK for a third party to make a trade with a player who is about to lose? I play with some serious board gamers, but we have neglected Monopoly for a number of years, so our knowledge is mostly based on high school &amp; house rules. We played last week and enjoyed it, but there was a piece of contention. There are times where we decide that we don't like one of our friends for some reason and don't want them to win (i.e. we landed on their property a bunch, or they refused to make a deal, etc.). So when player 1 has some property and player 2 lands on it and cannot pay the rent their assets (houses/hotels get liquidated), their property gets transferred to the other player. (Please correct me if I'm wrong.) In this case, though, player 3 \"traded\" the amount of money owing for a piece of property (way overpaid). In this case they did it so that player 1 would not get the properties. Player 2 had no chance of winning the game (all properties mortgaged, no cash to speak of and many of the other properties with 3+ houses/hotels on them). To summarize: Is it OK for a third player to purchase/trade property or cash to/from a player who is about to lose?", "When you are viewing an app in Google Play store, it displays the following : Updated, Size, Installs, Current Version, Requires Android, and Rating. I am trying to do some research and figure out the initial release / publish dates of different apps. Is there a way to get this information from Google Play, or perhaps a website with this information?", "Solutions of $x^2 \\equiv 1 \\pmod N$", "In Newtonian mechanics, if we throw an object in against direction of gravity with speed $v$ and it achieve max height of $h$. Now if we allow object to fall from that height $h$, it will eventually attain speed $v$ when it reach position where we launch it. Now applying same idea to a black hole in general relativity. Speed require to escape black hole gravity is greater than $c$, so if we throw something into black hole with almost the speed of light, the object speed will exceed speed of light $c$ before hitting black hole surface! How relativity explain this? Can space-time curvature reduce speed of this freely falling object from attaining speed of light?", "Generic constraints, where T : struct and where T : class", "How to replace spaces with newlines/enter in a text-file? I have simple text file named \"example\". Reading with terminal command: cat example Output: abc cdef ghi jk lmnopq rst uv wxyz I want to convert (transform) into following form: (expected output from cat example) abc cdef ghi jk lmnopq rst uv wxyz How can I do this via the command-line? (This is only an example file, I want to convert word's position in vertical-column)", "Why does the question's closed status disappear when clicking to load a new edit?", "Are taglines & signatures disallowed? I recently had a number of my valid answers voted down because people objected to the fact that I added a tagline to the end. The answers were correct for the questions asked and the downvotes were only due to the tagline regarding hiring, which said: We're hiring! Developers and QA in Washington, DC area (or looking to relocate) should send resumes to careers@example.com. Are taglines and signatures disallowed? For more information, see \"\" in the .", "\"provide\" vs. \"provide with\" I am wondering if the following sentence is correct: We add the information their study provides with to our article. The context is: their study provides with some information. And we add the information to our article. I want to keep the word \"add\", and someone told me that \"provides with to\" sounds wired...", "It's often the case that I want to change name servers because my site is messed up. Well, it takes a very long time for the name server to propagate. Is there something in DNS, or registrar or anything I can do to speed that up. Flushing my dns server using and it rarely works", "Do I need an ESTA to enter the US with the Victoria Clipper ferry? I am thinking of visiting Victoria, BC in Canada and then going to Seattle, WA in the US, with the . I am a national of a country under the Visa Waiver Program. I think that if I enter by air, I need to fill an ESTA form. If I enter by car, I don't need one, I can fill a form when crossing the border. With the ferry, what is the procedure? Should I necessarily have an ESTA?", "Is there a direct physical interpretation for the complex wavefunction? The Schrödinger equation in non-relativistic quantum mechanics yields the time-evolution of the so-called wavefunction corresponding to the system concerned under the action of the associated Hamiltonian. And this wavefunction is, in general, complex, and its modulus squared yields the probabilities observed experimentally. Though, perhaps, this question has been asked many times, I am wondering if there is a direct physical interpretation - something that physically corresponds to - the wavefunction. Or is it just an intermediate calculational tool to arrive at the appropriate predictions for experimental outcomes, and nothing more? Of course, things like superposition and interference effects follow from the complex nature of the probability amplitude. So there must be something physical about it. What is it? Or are we not supposed to ask that question? Is it because the probability amplitude is complex that we have difficulty in relating it to something physical? Can we do quantum mechanics without complex numbers?", "If no spell can reawaken the dead, how did the resurrection stone work? Dumbledore himself said that no spell can reawaken the dead. Isn't that the main objective of the resurrection stone? If one can't reawaken the dead then what is the use of the stone? Surely then one of the Hallows is flawed?", "What does a program do when it's sent SIGKILL signal? When I used killall -9 name to kill a program, the state become zombie. Some minutes later, it stopped really. So, what's happening during those minutes?", "Often I need to recall the different \\tracing commands; and a couple of times I stumbled on some webpages that worked fine for me; sadly, I didn't keep them, and my searches don't take me there anymore. So I thought I'd ask about links to where one can read a list of \\tracing commands? For instance, mentions: \\tracingall \\tracingassigns \\tracingcommands \\tracinggroups \\tracingifs \\tracinglostchars \\tracingmacros \\tracingnesting \\tracingonline \\tracingoutput \\tracingpages \\tracingparagraphs \\tracingrestores \\tracingstats \\tracingscantokens .. but, I'm pretty sure there was something like \\tracingboxes (and not so sure if there was something like \\tracingglues); yet I cannot find any resources mentioning those." ]

[ "Span class in opennlp is not working", "$\\Bbb{Z}_{26} \\rtimes_{\\alpha} \\Bbb{Z}_{5} \\cong \\Bbb{Z}_{26} \\times \\Bbb{Z}_{5}$ as groups.", "Famous puzzle: Girl/Boy proportion problem (Sum of infinite series)", "The book says: Concentration. Some spells require you to maintain concentration in order to keep their magic active. If you lose concentration, such a spell ends. So what happens if, for example, you are already concentrating on a spell, and cast Witch Bolt without concentrating. Would you get the initial arc of blue energy, or would it not even go off? I am asking if you can cast a spell that says concentration without concentrating for an immediate effect. This would be useful to avoid interrupting your existing concentration. In essence, if you are concentrating on thing A (doesn't have to be a spell since other things need concentration), can you cast a concentration spell getting an immediate effect without losing concentration on thing A? Since the definition of concentration is to keep the spell active (meaning it is already active) I would think that you would get the initial effect (if it had one) without the need to concentrate on it.", "Deny access to a webpage using web.config", "Allow a user to read some other users' home directories", "Some lands have an ability to become a creature, but they usually say they are still a land. If a land is a 3/3 creature and a land, can you target and kill it with a to send it to the graveyard, or does it remain in play as a land?", "Cycles final render pitch black? In solid mode with Material or Texture, it is shown fine. But in the Render mode, everything is pitch black. I have a sun, and the Opacity of the scene is set to 100%. I am new to using Blender, so I have no idea what is wrong. If you could help, I would appreciate it. If you need more information to help me, I would be glad to give it.", "Use $\\delta-\\epsilon$ to show that $\\lim_{n\\to\\infty} a^{\\frac{1}{n}} = 1$? Hope this is a meaningful question, but I'm curious if is possible to show that $$\\lim_{n\\to\\infty} a^{\\frac{1}{n}}=1, \\text{where }a&gt;0$$ using $\\delta-\\epsilon$ directly or other methods. One method that I am aware of is to use the following: If $\\{s_n\\}$ is a nonzero sequence, then $\\liminf\\bigl|\\frac{s_{n+1}}{s_n}\\bigr|\\le \\liminf |s_n|^{\\frac{1}{n}}\\le \\limsup |s_n|^{\\frac{1}{n}}\\le\\limsup\\bigl|\\frac{s_{n+1}}{s_n}\\bigr|$", "Some examples include: We fear the damned. He honored our fallen. This is a given. You are the chosen. The lost were among us. They obey the venerated. My beloved kissed me. (TIL “beloved” is a verb thanks to RegDwight АΑA) Is there a word to describe the past participle used as a noun? I’m hesitant to refer to it as a gerund, since it doesn’t end in -ing. Another possibility is adjectival noun, if you originally treat the word as a participle (e.g. “the damned man”) that has given up its modified noun. Also, why does English tend to preface such nouns with the?", "How to not count blank pages in frontmatter of two-sided document", "The Find Familiar spell states, in part: As an action, you can temporarily dismiss your familiar. It disappears into a pocket dimension where it awaits your summons. The question arising from this is: Is this pocket dimension different for every familiar in the world? Thus being a personal pocket dimension? If this is true, then it should be able to store items given by its master for safe keeping away from anyone else, as long as these are items that a familiar could carry with it. Can the familiar bring small items with it into the pocket dimension for safe keeping?", "I read about Drupal behaviors today, and I tried writing the following code. (function ($) { Drupal.behaviors.mymodule = { attach: function (context, settings) { $('#mymodule_id', context).change(function () { alert('Handler for .change() called.'); }); } }; }(jQuery)); Is Drupal.behaviors.mymodule the namespace? What are the context and settings parameters passed to the Drupal behavior? Is this the equivalent of document.ready()? Can I attach any number of functions? Can I define JavaScript functions which will be called somewhere?", "Is there any way to recover deleted files which may have since been overwritten? I deleted lots of files &amp; folders on my laptop and then I put a new files in the same folders. I need to recover the deleted files. I tried a lot of recovery software and I couldn't recover my old files. I read that if you refill the folders with new files after deleting old ones then I can't recover them again. Is that true? What should I do?", "What are the rules of parallelism? I've been reading a lot about it since yesterday and all I encounter is \"They must have the same grammatical form\"? What does this exactly mean? I know how to make parallel sentences with gerunds. The things get trickier when it comes to using modifiers. For example: I love using the phone that you bought me and the computer. On the left side of the conjunction there is a noun phrase that consists of an article + noun + another modifier and on the right side there is an article + noun. They are both noun phrases but the first one has additional modifier. Is that still considered a parallel sentence? Another example: I like to swim and to feel good. Here on the right side of the conjunction there is an infinitive and on the left side there is an infinitive + complement? Is that parallel?", "Is it safe to give out one's bank account number? I'm managing the utility of the house and I'm sharing with another person. He asks me to provide my bank account number, so that he can transfer his money to my account when paying the utility. I wonder if it is safe to give out my bank account number? For example, if I'm correct, many online payments just need the account number to draw money out of it. Is giving out the bank account number safer than handing a check to another person, since there is also the account number printed on the check?", "What is safe to exclude for a full system backup? I'm looking for a list which paths/files are safe to exclude for a full system/home backup. Considering that I have a list of installed packages. /home/*/.thumbnails /home/*/.cache /home/*/.mozilla/firefox/*.default/Cache /home/*/.mozilla/firefox/*.default/OfflineCache /home/*/.local/share/Trash /home/*/.gvfs/ /tmp/ /var/tmp/ not real folders but can cause severe problems when 'restoring' /dev /proc /sys What about... /var/ in general? /var/backups/ - can get quite large /var/log/ - does not require much space and can help for later comparison /lost+found/", "How to remove items from the right click (context) menu in Windows? The is minimal and clean on a fresh installation of Windows. Install a bunch of applications and soon the context menu is loaded with all kinds of opening options from various applications. How do I remove items from the right click (context) menu? I find that there are different types of right click menu items: Global items that appear in all context menus. Items that appear only on folders. Items that appear only on files. Items that appear only on special folders (Ex: Right clicking a folder of MP3s shows up a context menu with items like Play with Windows Media Player.) Items that appear only on certain file types (Ex: Right clicking a MP3 file shows up a context menu with items from Windows Media Player/Foobar2000/VLC/your-favorite-media-player begging to open this file.) I want to be able to delete all these kinds items from the right click (context) menu.", "Derivative of $f(x)=|x|$", "When I am faced with a simple linear congruence such as $$9x \\equiv 7 \\pmod{13}$$ and I am working without any calculating aid handy, I tend to do something like the following: \"Notice\" that adding $13$ on the right and subtracting $13x$ on the left gives: $$-4x \\equiv 20 \\pmod{13}$$ so that $$x \\equiv -5 \\equiv 8 \\pmod{13}.$$ Clearly this process works and is easy to justify (apart from not having an algorithm for \"noticing\"), but my question is this: I have a vague recollection of reading somewhere this sort of process was the preferred method of C. F. Gauss, but I cannot find any evidence for this now, so does anyone know anything about this, or could provide a reference? (Or have I just imagined it all?) I would also be interested to hear if anyone else does anything similar." ]

[ "Upon realizing it is a sarcophagus, he decides to sacrifice himself (I think by disconnecting his air) and exist in it for eternity along with the original creature. It may have been in an old Omni magazine, or some other periodical. I thought it may have been in the anthology \"Dead Astronauts\" but I did not find the story in there.", "Fighter War Magic, Using Booming Blade / GFB If my Fighter (Eldritch Knight) use War Magic (PHB p. 75) to use the cantrip Booming Blade, will I be able to use my Extra Attack, and bonus action attack, to make 3 attacks at level 7?", "'Good' review audits can be misleading", "Abount linear functional: If $T(B)$ is bounded, is $T$ bounded? Let $H$ be a infinite dimensional Hilbert space and let $B$ be a basis of $H$ that $H=\\overline{span(B)}$ moreover, let $T : H \\rightarrow K$ be a linear functional If $T(B)$ is bounded, is $T$ bounded?", "Punctuation in an indirect quotation", "It used to be that the new, super wide, touch friendly context menu style that Google introduced a few versions of Chrome ago could be turned off using the start up flag \"--disable-new-menu-style\". As of Chrome 28, this is no longer the case, and as a desktop user it is very irritating to see menus that previously fit in the screen not to do so anymore — I don't think I can get used to it. Is there any way around it? If the flag is gone for good, can the style of the context menus be perhaps edited with custom css like the web inspector?", "Software Tester Skill Matrix with Levels I would like to know if there's a standard Skill set for Skill Matrix for a Software Tester of different levels, like for example, what are the skills needed for an Entry level tester as well as what technologies and responsibilities he needs. And for the Mid Level tester and Senior Level as well. Note that I am working in a company who designs and develops websites.", "How do they decide Blu-ray/DVD release date? I think my question is different from . Some movies' productions release Blu-ray/DVD so early after theatrical release, others will take time. How do they decide for the Blu-ray/DVD release date?", "Can you grab the blue shirts and socks? Is the above sentence stating that both the shirts and the socks are blue? Or only the shirts? At this stage, I am leaning towards the earlier (only the shirts) — though writing \"Can you grab the blue shirts and blue socks?\" seems redundant.", "I'm trying to use the Html.DropDownList extension method but can't figure out how to use it with an enumeration. Let's say I have an enumeration like this: public enum ItemTypes { Movie = 1, Game = 2, Book = 3 } How do I go about creating a dropdown with these values using the Html.DropDownList extension method? Or is my best bet to simply create a for loop and create the Html elements manually?", "How do you set a default value for a MySQL Datetime column? In SQL Server it's getdate(). What is the equivalant for MySQL? I'm using MySQL 5.x if that is a factor.", "Several wands and other magic items in the DMG cite &quot;spellcaster&quot; as an attunement requirement, specifically &quot;requires attunement by a spellcaster&quot; while others list multiple spellcasting classes (e.g., a Staff of Fire &quot;requires attunement by a druid, sorcerer, warlock, or wizard&quot; p. 201). However, all the DMG states in this regard is: Some magic items require a creature to form a bond with them before their magical properties can be used. This bond is called attunement, and certain items have a prerequisite for it. If the prerequisite is a class, a creature must be a member of that class to attune to the item.¹ (If the class is a spellcasting class, a monster qualifies if that monster has spell slots and uses that class's spell list. [emphasis and footnote added] (p. 136) The language of the Mage Slayer feat describes a spellcaster as a creature casting or concentrating on a spell. You have practiced techniques useful in melee combat against spellcasters [...] When a creature within 5 feet of you casts a spell ... [and] When you damage a creature that is concentrating on a spell ... (PHB, p. 168) From the above, it does not appear that &quot;spellcaster&quot; would necessarily be considered a class or group of classes, so Are characters that can cast spells, regardless of their class(es), considered spellcasters? Or, put another way, Does &quot;spellcaster&quot; (as an attunement prerequisite) mean any creature who can cast a spell or does it mean all classes with the Spellcasting feature? I can think of five particular cases—innate abilities, two subclasses and two feats: High Elves know one wizard cantrip (0-level spell) of their choice. Drow can cast the dancing lights cantrip, 1st-level spell faerie fire and 2nd-level spell darkness. Forest Gnomes know the minor illusion cantrip, and Tieflings can cast the thaumaturgy cantrip and 2nd-level spells hellish rebuke and darkness. Also, many monsters have innate spellcasting abilities, which would trigger the Mage Slayer feat. Starting at 3rd level, both the Eldritch Knight (Fighter Martial Archetype) and Arcane Trickster (Roguish Archetype) gain the ability to cast wizard spells and gain wizard spell slots (potentially) up to 4th-level spells. PHB, pp. 75 &amp; 98. The latter's 17th-level Spell Thief feature also states &quot;you gain the ability to magically steal the knowledge of how to cast a spell from another spellcaster,&quot; (Ibid.) which strongly implies that (at least) the Arcane Trickster is a spellcaster, although neither subclass is specifically listed as a prerequisite for any magic item in the DMG. Eldritch Knight and Arcane Trickster are also found under Multiclassing, Spell Slots in the PHB: You determine your available spell slots by adding together all your levels in the bard, cleric, druid, sorcerer, and wizard classes, half your levels (rounded down) in the paladin and ranger classes, and a third of your fighter or rogue levels (rounded down) if you have the Eldritch Knight or the Arcane Trickster feature. (p. 164) With the Ritual Caster feat, a character chooses a spellcasting class (except paladin or ranger) and gains the ability to cast spells of that class with the ritual tag as rituals. The character immediately gets two 1st-level ritual spells of that class and has the potential to (eventually) learn all of the ritual spells of the chosen class. PHB, p. 169. With the Magic Initiate feat, a character chooses a particular spellcasting class (except paladin or ranger) and immediately learns two cantrips and one 1st-level spell from the class with no further advancement. PHB, p. 168. By definition, it seems all of the above would qualify as spellcasters, but I feel spellcaster typically (or maybe traditionally) refers to bard, cleric, druid, paladin, ranger, sorcerer, warlock and wizard. I believe an exception would be a 13th level or higher Thief (Roguish Archetype) due to the Use Magic Device feature. PHB, p. 97.", "What should the standard spelling be - British or US? I just saw someone edit the title of question to the spelling from favourite (The British spelling) to favorite (The US-English spelling). Does SOFU have an accepted standard on language and spelling? Which is it?", "When a land becomes creature, can you kill it? Some lands have an ability to become a creature, but they usually say they are still a land. If a land is a 3/3 creature and a land, can you target and kill it with a to send it to the graveyard, or does it remain in play as a land?", "Solve $\\int_0^{+\\infty} \\Big(\\frac{\\sin t}{t}\\Big)^2 \\ dt$", "How do I survive in the Nether? Whenever I travel to the Nether in Minecraft, I almost instantly get blasted to smithereens and chopped up into little pieces. How do I survive in the Nether, at least long enough to build some sort of shelter and get situated?", "Evaluate the limit $$ \\lim_{n\\rightarrow \\infty}\\left(\\frac{n+1}{n}\\right)^{n^2}\\cdot \\frac{1}{e^n} $$ My Attempt: $$ \\lim_{n\\rightarrow \\infty}\\left(\\frac{n+1}{n}\\right)^{n^2}\\cdot \\frac{1}{e^n} = \\lim_{n\\rightarrow \\infty}\\left(1+\\frac{1}{n}\\right)^{n^2}\\cdot \\frac{1}{e^n} $$ How can I solve the problem from this point?", "Moderators accepting answers on user's behalf after a certain time period", "How to disable the \"Your site has updated to WordPress x.y.z\" admin email? Using the automatic update of my self-hosted WordPress blogs, I configured automatic updates of both the WordPress core as well as WordPress plugins and themes (). Whenever a core update occurs, I get an email like: Your site has updated to WordPress 3.9.2 Howdy! Your site at has been updated automatically to WordPress 3.9.2. No further action is needed on your part. For more on version 3.9.2, see the About WordPress screen: If you experience any issues or need support, the volunteers in the WordPress.org support forums may be able to help. The WordPress Team I understand that I can but I would prefer to only disable the above notification. Therefore my question is: How to disable update notification emails in WordPress?", "I have a mathematical problem with the following formula. The goal is to transform this equation to have a seperated real and imaginary part. I have already done this with several other equasions, but for this particualar one I don't know where to start. I dont expect you to do the complete work of transforming for me, it would already be very nice if you could give me a hind on how you would start. Thank you in advance! C||RLC This is my current progress: My question is: How can I get rid of the imaginary part jωC2*R? When the denominator is completely real I can just split up the formula and have an imaginary and a real part." ]

[ "When and how did \"momentarily\" come to mean \"in a moment\", rather than \"for a moment\"? \"Momentarily\" used to mean \"for a moment\" only, and not \"in a moment\". Thus, newscasters could be divided into two clear groups: those who would say \"we'll be back momentarily,\" and those who would not. This restriction made sense to me, because having both definitions would promote ambiguity if a unique interpretation could not always be derived from the context. But in recent years it seems \"momentarily\" is regularly, maybe even more often, used to mean \"in a moment\" by newscasters of every caliber, and in fact this is even shown to be the definition when looked up in most dictionaries. When did this word's meaning change? How did it come about?", "Difference between focusin/focusout and focus/blur, with example", "How to combine Bump Maps? I'm trying to add a bump map with logo to noise texture Bump map. I have a bump map created with Noise texture and then on top of that I want to add my bump logo (which also has it's own color on it.) Is it possible within one material?", "Does GTA V Online Network Merge Xbox 360 and PS3 players?", "make iframe height dynamic based on content inside- JQUERY/Javascript", "I have two layers, one (A) has point features and the other (B) has polygons. How do I produce a new table with some (the ID) or all the fields from the A table and some (the area code) or all from the B table where the B polygon contains the A point? I am using QGIS.", "Inequality involving $\\limsup$ and $\\liminf$: $ \\liminf(a_{n+1}/a_n) \\le \\liminf((a_n)^{(1/n)}) \\le \\limsup((a_n)^{(1/n)}) \\le \\limsup(a_{n+1}/a_n)$ This may have been asked before, however I was unable to find any duplicate. This comes from of \"Mathematical Analysis: An Introduction\" by Browder. Problem 14: If $(a_n)$ is a sequence in $\\mathbb R$ and $a_n &gt; 0$ for every $n$. Then show: $$ \\liminf(a_{n+1}/a_n) \\le \\liminf((a_n)^{(1/n)}) \\le \\limsup((a_n)^{(1/n)}) \\le \\limsup(a_{n+1}/a_n)$$ The middle inequality is clear. However I am having a hard time showing the ones on the left and right. (It seems like the approach should be similar for each). This is homework, so it'd be great if someone could give me a hint to get started on at least one of the inequalities. Thanks.", "What plane type will I need to go transatlantic in Pocket Planes? I'm based in North America and have a bunch of major airports on the Eastern Seaboard. I'm level 14 and just unlocked the Pearjet, but I still don't have a plane with enough range to make it across the Atlantic. What's the first plane I'll get that will let me make that crossing? Or more specifically, what's the range from New York (or Boston) to London (or Lisbon) - the smallest range that'll get me across?", "I need to (permanent) redirect all of the following: www.example.com www.example.com/folder sub.example.com sub.example.com/folder Basically, all URLs that are reachable without being intended to: www.new-example.com, I want to do this within Apache and using the mod_rewrite module via the .htaccess file.", "Local SEO Strategies What are your strategies for local SEO? For example, if you had a web design company in Lincoln, Nebraska, what would you do for your website from an SEO perspective?", "How can we recover the Newtonian gravitational potential from the metric of general relativity? The Newtonian description of gravity can be formulated in terms of a potential function $\\phi$ whose partial derivatives give the acceleration: $$\\frac{d^2\\vec{x}}{dt^2}=\\vec{g}=-\\vec{\\nabla}\\phi(x)=\\left(\\frac{\\partial\\phi}{\\partial x}\\hat{x}+\\frac{\\partial\\phi}{\\partial y}\\hat{y}+\\frac{\\partial\\phi}{\\partial z}\\hat{z}\\right)$$ However, in general relativity, we describe gravity by means of the metric. This description is radically different from the Newtonian one, and I don't see how we can recover the latter from the former. Could someone explain how we can obtain the Newtonian potential from general relativity, starting from the metric $g_{\\mu\\nu}$?", "This morning I upgraded my system to Windows 10 2004, the upgrade went smooth and was through Windows Update. I am using Hyper-V as my virtualization program for virtual machines and to provide extra layer of protection to the system through core isolation. After the upgrade, I noticed that a new Virtual Switch was created with the name &quot;vEthernet (Ethernet)&quot; where &quot;Ethernet&quot; within the parentheses is the name of my primary network adapter. Also noticed this behavior has a specific pattern of creating new vSwitches correspond to the adapters you have, e.g. if you created a new Virtual Switch and restarted the system, a new additional switch will appear with the name &quot;vEthernet (your-new-switch-name)&quot;. Tried to remove Hyper-V and reinstall it but no luck. I am aware of a similar on SuperUser but has no answers on it. Any clues for the root of the problem?", "Proof of Frullani's theorem", "I have a table that I want to insert on a page, but at least one (perhaps both) of the following conditions are met: The table is too wide to fit within the text block or page. That is, I'm exceeding some horizontal restriction. The table is too tall to fit within the text block or page. That is, I'm exceeding some vertical restriction. What are my options to make this table fit? If it doesn't fit, regardless of my attempts, what other options exist?", "Ubuntu touchpad issues - mouse pointer jumps around", "Finding $\\int_0^\\infty \\frac{\\cos(ax)-\\cos(bx)}{x}dx$ I am practicing calculus section of GRE Math Subject test, and I can't figure out a way to do the following integral: $$\\int_0^\\infty \\frac{\\cos (ax) - \\cos (bx)}{x}dx.$$ I absolutely have no clue how to do this. Can someone show me the solution explicitly? Thank you.", "Conjugate subgroup strictly contained in the initial subgroup?", "Are there naturally occurring lasers?", "Singular or plural verb with two subjects Possible Duplicate: I'm writing an interrogative sentence questioning someone else's writing: \"Is grammar and spelling correct?\" Can I use the singular verb \"is\" or must it be the plural verb \"are\"? (The sentence is one of a list of interrogative questions about the quality of writing, e.g. \"Are words in the right order?\" \"Does the copy flow?\")", "Screen goes white when posting a comment" ]

[ "Given an infinite number of monkeys and an infinite amount of time, would one of them write Hamlet? Of course, we've all heard the colloquialism \"If a bunch of monkeys pound on a typewriter, eventually one of them will write Hamlet.\" I have a (not very mathematically intelligent) friend who presented it as if it were a mathematical fact, which got me thinking... Is this really true? Of course, I've learned that dealing with infinity can be tricky, but my intuition says that time is countably infinite while the number of works the monkeys could produce is uncountably infinite. Therefore, it isn't necessarily given that the monkeys would write Hamlet. Could someone who's better at this kind of math than me tell me if this is correct? Or is there more to it than I'm thinking?", "I need to define a new command to create a squiggle arrow with some text on it. Something similar to what \\xrightarrow command produces but with wiggly arrows as in \\rightsquigarrow. The length of the arrow should automatically be adjusted to fit the text above it and I do not know how to handle this part in TikZ. Any ideas would be much appreciated.", "Putting a table next to a figure", "Minipage: 2 tables side by side isn't working I have the following code to layout two tables side by side: \\begin{minipage}{0.3\\textwidth} \\begin{tabular}{c | c | c | c | c | c | c} F &amp; D &amp; E &amp; G &amp; P &amp; A &amp; L\\\\ \\hline C &amp; H &amp; I &amp; I &amp; U &amp; G &amp; F\\\\ \\hline G &amp; Z &amp; G &amp; A &amp; F &amp; Z &amp; U\\\\ \\hline F &amp; R &amp; \\textbf{H} &amp; \\textbf{A} &amp; \\textbf{U} &amp; \\textbf{S} &amp; Z\\\\ \\hline R &amp; P &amp; L &amp; I &amp; N &amp; F &amp; H\\\\ \\hline L &amp; U &amp; G &amp; I &amp; A &amp; C &amp; T\\\\ \\hline A &amp; B &amp; D &amp; N &amp; E &amp; R &amp; Z\\\\ \\end{tabular} \\end{minipage} \\begin{minipage}{0.3\\textwidth} \\begin{tabular}{c | c | c | c | c | c | c} F &amp; D &amp; E &amp; G &amp; P &amp; A &amp; L\\\\ \\hline C &amp; H &amp; I &amp; I &amp; U &amp; G &amp; F\\\\ \\hline G &amp; Z &amp; G &amp; A &amp; F &amp; Z &amp; U\\\\ \\hline F &amp; R &amp; \\textbf{H} &amp; \\textbf{A} &amp; \\textbf{U} &amp; \\textbf{S} &amp; Z\\\\ \\hline R &amp; P &amp; L &amp; I &amp; N &amp; F &amp; H\\\\ \\hline L &amp; U &amp; G &amp; I &amp; A &amp; C &amp; T\\\\ \\hline A &amp; B &amp; D &amp; N &amp; E &amp; R &amp; Z\\\\ \\end{tabular} \\end{minipage} But it doesn't work. The tables are one below the other. What am I doing wrong?", "Tikzpictures side by side", "X Windows special programs: do some of these still exist?", "Find all n such that $\\phi(n) = n/2$ My idea for the solution is something like this: Since $2 | n$, $n = 2^a p_1^{e1} p_2^{e2} \\cdots p_t^{et}$ where $a \\geq 1$. Then, $n/2 = \\phi(2^a) \\phi(p_1^{e1}) \\phi(p_2^{e2}) \\cdots \\phi(p_t^{et})$. Looking at the case that $t = 0$, $n/2 = \\phi(2^a) = 2^{a-1}$, and therefore $n = 2^a$. Otherwise, $n = 2^a \\phi(p_1^{e1}) \\phi(p_2^{e2}) \\cdots \\phi(p_t^{et}) = n = 2^a p_1^{e1} p_2^{e2} \\cdots p_t^{et}$. Since $\\phi(n) &lt; n$, this is a contradiction, and therefore, the only $n$'s that apply are the powers of 2. Is this right? Also, we were asked to find $n$ such that $\\phi(n) = n/3$. How would I go about that one?", "How to transfer between International T2 to Domestic 1B terminals in Mumbai? I will be arriving in Mumbai Terminal T2 on a Turkish Airlines international flight. I have a separately-purchased IndiGo ticket 5 hours later from Terminal 1B (Domestic). In the past I heard of a free bus to transfer. Is that still the case and if not how do I get to Terminal 1B from Terminal 2?", "What is the difference between 32-bit and 64-bit Ubuntu? I've heard the 64-bit platform performs better and can detect more than 4GB of RAM. Also, while some apps haven't ported to 64-bit yet, ia32-libs lets a 64-bit machine run them. If so, why not promote 64-bit over 32-bit?", "In Magic, at the start of the game, you draw 7 cards. How would you calculate the likelihood of drawing a specific card in your opening hand? For example, let's say I have a 60 card deck, and I'm running 4 . What is the percent chance that I will have at least one Bird in my opening hand?", "Show that $\\mathbb{Q}(\\zeta_n)$ is Galois over $\\mathbb{Q}$ and $Gal(\\mathbb{Q}(\\zeta_n)/\\mathbb{Q}))\\cong \\mathbb{Z_n}^*$ Question 1: For $n \\in \\mathbb{N}$ explain why $\\mathbb{Q}(\\zeta_n)$ is Galois over $\\mathbb{Q}$ We must show that it is normal and separable. $\\mathbb{Q}(\\zeta_n)/\\mathbb{Q}$ is normal since it is a splitting field for $X^n-1 \\in\\mathbb{Q}[X]$ (I think... Is this correct?). It is separable because it is of characteristic $0$ Question 2: $Gal(\\mathbb{Q}(\\zeta_n)/\\mathbb{Q}))\\cong \\mathbb{Z_n}^*$ Is this because the primitive nth root of unity $\\zeta_n$ acts as a generator for a cyclic group? I am unable to fill out a decent proof on this. Thanks for your help", "Trying to use \"Difference\" tool gives out \"'QgsWKBTypes' is not defined\" error I am trying to separate two overlapping vector layers and find out the difference in QGIS 2.18. I have tried finding difference with layers with points and also with buffers. Both of them give following error: global name 'QgsWKBTypes' is not defined See log for more details I have searched the web for this but can't seem to find a solution.", "Is it possible to use an Ubuntu Live CD and run GParted to partition a my HDD (including the partition that is usually mounted on a given system)? I'm encountering a problem with my HDD's partitions and can't resize it. I've described my problem and my system here: . Now, from a more general perspective, I was thinking on whether it is possible to use an Ubuntu Live CD and use GParted in a live session to possibly go around that problem. Is that possible? I made a separate question as I'm interested in the possibility independently from my current problem. You see, I only have one partition and that's mounted. When I use GParted through Ubuntu I don't get any error reports (unlike the case reported in the question linked above). Thanks beforehand.", "I am calculating the class group of $\\mathbb Q(\\sqrt 6)$. My working is as follows: The Minkowski bound is $\\lambda(6)=\\sqrt 6&lt;3$ so we only need to look at prime ideals of norm $2$. $2$ divides the discriminant, $24$, of $\\mathbb Q(\\sqrt 6)$, so $2$ ramifies, and so for any prime ideal $\\mathfrak p$ of norm $2$, $\\mathfrak p^2$ is principal. But $(2, \\sqrt 6)^2=(2)$, so $\\mathfrak p=(2, \\sqrt 6)$ has norm $2$. If I can show $\\mathfrak p$ is not principal, then I can conclude that $Cl(\\mathbb Q(\\sqrt 6))\\cong C_2.$ But if there was an element of $\\mathcal O_{\\mathbb Q(\\sqrt 6)}$ of norm 2, this would correspond to a solution of the diophantine equation $x^2-6y^2=2$. Clearly $x$ is even, so writing $x=2n$ we get $2n^2-3y^2=1$. Now reducing modulo $3$, we get $2n^2\\equiv 1 \\pmod 3$ which has no soultions. Hence $\\mathfrak p$ is not principal and $Cl (\\mathbb Q(\\sqrt 6)) \\cong C_2.$ However, says that the class group is trivial. Where have I gone wrong? What am I misunderstanding? Is $(2, \\sqrt 6)$ principal?", "I need to write a small program that can detect that it has been changed. Please give me a suggestion! Thank you.", "Let's say I have a script that will be executed on various machines with root privileges, but I want to execute certain commands within that script without root. Is that possible?", "Does there exist an $a_0$ such that the sequence $a_{n+1} = 2a_n + 1$ is prime for all $n \\ge 0$? I believe I see that $a_n = 2^n(a_0+1) - 1$ but am somewhat uncertain where to proceed afterwards. I am a complete beginner at number theory and would appreciate it if someone could point me in the right direction--surely there is some obvious argument I am missing.", "Evaluating $\\int_{-\\infty}^{\\infty}\\frac{1}{(x^2+b^2)^2}dx$", "As I finished programming the MCU in the Arduino Uno board to receive some RF Signal and drive relays, I moved it into a standalone board I made with Eagle. The circuit is pretty basic, the MCU receives data from a RF Receiver, processes it and then turns on/off some pins that drive 5V relays (through transistors, of course). When I test it on the Arduino Board, you can see that the LEDs toggle ON and OFF whenever I send the data through the RF Transmitter. You send once, it toggles ON, you send another time, it toggles OFF and so on. This works for all the 4 PINS that it has programmed. In my standalone board, each of these four pins are connected to transistors that drive 5V relays. The problem is that only one pin seems to activate, and then it won't even toggle OFF, like you send the data once and you can hear the relay's coil go ON, but then if you try to toggle it OFF it just won't, it's latched ON and I have to unplug and plug the USB cable again to reset it. The ATMEGA328P has a 16MHz crystal, two 22pF caps for the crystal, and a 10K resistor that goes from the Reset Pin to VCC. I'm not sure why the MCU behaves so weird in my board. There's also another VERY weird detail I didn't mention. If instead of using the RF Receiver, I connect the Data Output pin of the PIC that drives the RF Transmitter directly into the Receiver board, that one pin I mentioned that works is able to toggle OFF and ON again, but still, the other pins just don't work. I've tested it not only by hearing the relay's coil but also by using a multimeter. Any help would be really appreciated. EDIT: Here is the Eagle Schematic of the board: It's true that I really didn't concern about the noise, but since it was quite a simple project I didn't think that noise was going to attack so violently, plus I don't really know how to protect the circuit from inductive noise. Thank you for answering fast! EDIT 2: Okay so here goes more detail: Real photos: The soldering seems quite awkward but I probed all the traces to check for continuity. I could make some extra holes to, for example, add a 100nF decoupling capacitor for the MCU and so, but if you think I should enhance the schematic and add a lot more components, then I'll gladly remake the board. About the supply, right now (for debugging) I'm connecting the Arduino Uno to a Cellphone Charger (Notebook won't supply enough current for relays), and I'm connecting those red and black cables to the Arduino Uno. I'm using that Cheap 433MHZ RF Receiver so if the circuit is so vulnerable to noise as you say, it may also be getting fouled up by the noise.", "How to make all faces flip to the right/consistent direction? What's happening is that I have tried to flip the normals, inside and out, but there are always faces which have to be flipped! Normals recalculated Inside View If I flip them again, all faces get flipped and end up horrible and, not working at all. So how can I make all of the faces flip to the right direction?" ]

[ "Maximum value of $\\sin A+\\sin B+\\sin C$? What is the maximum value of $\\sin A+\\sin B+\\sin C$ in a triangle $ABC$. My book says its $3\\sqrt3/2$ but I have no idea how to prove it. I can see that if $A=B=C=\\frac\\pi3$ then I get $\\sin A+\\sin B+\\sin C=\\frac{3\\sqrt3}2$. And also maximum is attained for $a=b=c$. But this does not give me any idea for the proof. Can anyone help?", "To prove that if $ab\\equiv ac\\bmod n$ and $(a,n)=1$ then $b\\equiv c\\bmod n$", "I've always wondered about this and never found a good solution. But reminded me of it. When I have a URL on my website it can be displayed and accessed any of the following ways: http://www.somesite.com/subdirectory http://www.somesite.com/subdirectory/ http://www.somesite.com/subdirectory/index.htm http://www.somesite.com/subdirectory/index.html http://www.somesite.com/subdirectory/index.php http://www.somesite.com/subdirectory/index.asp http://www.somesite.com/subdirectory/some-relevant-keywords http://www.somesite.com/subdirectory/some-relevant-keywords.htm http://www.somesite.com/subdirectory/index.php?page=some-relevant-keywords http://www.somesite.com/subdirectory/?page=some-relevant-keywords http://www.somesite.com/subdirectory/?page=some-relevant-keywords&amp;even=more-keywords etc... Now, I can understand the merits of adding keywords in the URL. Even the most basic SEO guide will mention to do just that. ... but for the sake of sanity, clarity, ease of reading, ease of use, and so on, including web compliance ... Is it preferred to have a file-extension or not? Really, deep down my logic tells me: yes, it should. The reason being is this stems back to the days of the past when the internet was mostly USENET, FIDONET, FTP and GOPHER. See, if a URL has no filename, then it normally is considered a directory. This is where index.htm came about, because this by default lists the directory if no index file is found. However, soon enough, web programmers started overriding this and using index.htm to actually serve the content of that web directory as a page. The main difference, was markup language was added in, and this was parsed in the browser. With this markup language, the Content-Type:text/html; tag in the response header became the indicator to what filetype it was for any file. HTML seems to be the only \"filetype\" that just doesn't have consistently named extensions, except for when they are saved. Unfortunately, once web pages became the main thing, it became a security error to actually display the directory contents, so everything stayed hidden with only the actual URL content being displayed. Not to mention the cross-platform file-naming wars.. windows based require a 3 or less digit extension, and unix/mac can have more. So should it be .HTM or .HTML or NONE and let the platform decide? So in essence, I guess what I am trying to figure out is beyond SEO and dealing more with aesthetics and web compliance.", "How to derive variance-covariance matrix of coefficients in linear regression", "Profile avatar lost on several sites after profile edit (Gravatar replaced with Identicon) I have had the same network-wide profile avatar for many years; it's a custom image which I installed nework-wide soon after I registered for Stack Overflow back in 2011. I still see that image e.g. on and but not, for instance, on this site, or e.g. on (The example originally linked to my Unix &amp; Linux profile instead of Super User but I experimentally changed my profile back to the gravatar one there.) I routinely update my profile presentation text every few months, and did so again a few days ago. Comments below seem to indicate that others who recently edited their profile are experiencing the same problem. My preferred avatar is a Gravatar which is connected to my email address, which has always been the same (MD5 091f411d57db5be8298e057a32e5ad72). The replacement seems to be a generic identicon with a different MD5. I don't recall seeing this identicon as an option in my profile before: You'll notice that the gravatar is still visible as an option, but I can find no way to replace it on all sites in one go. I switched back to the gravatar one on Unix &amp; Linux and noticed that the help next to the \"Save\" button says Your profile will be updated on all public communities. but alas, that did not in fact happen. Do I really have to go over 170+ member sites and manually select my gravatar on each?", "I am using to show the branch name in gnome terminal (Ubuntu 15.10) when working in a git repository. Based on the above I now have the below in my ~/.bashrc file: # uncomment for a colored prompt, if the terminal has the capability; turned # off by default to not distract the user: the focus in a terminal window # should be on the output of commands, not on the prompt #force_color_prompt=yes ... # Add git branch if its present to PS1 parse_git_branch() { git branch 2&gt; /dev/null | sed -e '/^[^*]/d' -e 's/* \\(.*\\)/(\\1)/' } if [ \"$color_prompt\" = yes ]; then PS1='${debian_chroot:+($debian_chroot)}\\[\\033[01;32m\\]\\u@\\h\\[\\033[00m\\]:\\[\\033[01;34m\\]\\w\\[\\033[01;31m\\]$(parse_git_branch)\\[\\033[00m\\]\\$ ' else PS1='${debian_chroot:+($debian_chroot)}\\u@\\h:\\w$(parse_git_branch)\\$ ' fi unset color_prompt force_color_prompt As a result I now get: so it works. But why has the coloring of my user@host been removed? And I would also expect that the branch name should be colored. Before it looked like this: UPDATE: I have now tried this guide instead: adding this to .bashrc: parse_git_branch() { git branch 2&gt; /dev/null | sed -e '/^[^*]/d' -e 's/* \\(.*\\)/ (\\1)/' } export PS1=\"\\u@\\h \\[\\033[32m\\]\\w\\[\\033[33m\\]\\$(parse_git_branch)\\[\\033[00m\\] $ \" and that works: Notice in .bashrc I also have this (default): # uncomment for a colored prompt, if the terminal has the capability; turned # off by default to not distract the user: the focus in a terminal window # should be on the output of commands, not on the prompt #force_color_prompt=yes I have yet to find the reason why that snippet gives the correct result and the other version does not. Any input on this? Here is the version of my .bashrc that has the old snippet enabled that does not work:", "Why is the derivative of a circle's area its perimeter (and similarly for spheres)? When differentiated with respect to $r$, the derivative of $\\pi r^2$ is $2 \\pi r$, which is the circumference of a circle. Similarly, when the formula for a sphere's volume $\\frac{4}{3} \\pi r^3$ is differentiated with respect to $r$, we get $4 \\pi r^2$. Is this just a coincidence, or is there some deep explanation for why we should expect this?", "I have 4GB RAM. When I open Firefox, IntelliJ IDEA or VS Code and some other application my memory is about used up thus my machine hangs and I can't do anything. I can't even close any applications. Date and time are shown in the top bar so that I can view it any time without any thing typing. If I would view memory status in this way without typing anything then I can make a decision whether to open an application or whether this application may put my machine in hanging state or not. Is it possible in Ubuntu 18.04 LTS?", "Why didn't Harry die in the dark forest?", "Lost my APFS partition after using EaseUS partition manager on Bootcamp I used macOS mojave(APFS partition) and Windows10(Bootcamp). And I tried to expand Bootcamp partition with moving Windows OEM partition by EaseUS partition master in windows. After this, I can’t find APFS partition installed macOS. I use MacBook Pro 2016. I think “disk0s2” was APFS partition, but now it is “Windows Recovery” partition. Do you have any ideas to solve this? (I am Japanese, so I'm sorry for my poor English) I tried “gpt show” and “diskutil list” on macOS Recovery Additional information I tried dd if=/dev/disk0s2 count=1 bs=512 command in a Terminal app of macOS Utility from network boot, and the terminal says, -bash-3.2# dd if=/dev/disk0s2 count=1 bs=512 | vis -c 1+0 records in 1+0 records out 512 bytes transferred in 0.005472 secs (93568 bytes/sec) )us??-ҵ?\\^A\\0\\0\\0\\0\\0\\0\\0?\\M^F\\^Z\\0\\0\\0\\0\\0\\^A\\0\\0\\M^@\\0\\0\\0\\0NXSB\\0\\^P\\0\\0?\\M^B?\\^B\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\^B\\0\\0\\0\\0\\0\\0\\0\"\\^R???\\M^_@}\\M^Bvy57 ?(h?8\\0\\0\\0\\0\\0?\\M^F\\^Z\\0\\0\\0\\0\\0\\^X\\^A\\0\\0 l\\0\\0?\\M^J\\0\\0\\0\\0\\0\\0\\^R\\r\\0\\0\\0\\0\\0\\0\\a\\0\\0\\0004*\\0\\0\\^E\\0\\0\\0\\^B\\0\\0\\0\\^S*\\0\\0!\\0\\0\\0\\M^Qr8\\0\\0\\0\\0\\0\\M^U?\\b\\0\\0\\0\\0\\0\\^A\\^D\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0d\\0\\0\\0\\^C\\^D\\0\\0\\0\\0\\0\\0\\M^T\\M^N\\^A\\0\\0\\0\\0\\0\\M^V\\M^N\\^A\\0\\0\\0\\0\\0?0\\^B\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0\\0-bash-3.2# .", "ASP.NET MVC Default Project Structure and the Scripts Folder", "Sums in math mode: how to display index under the sigma sign? I have a fraction with sums above and under the line. How can I convince LaTeX to write the indices of the sums under the sigma instead of next to it? \\begin{displaymath} \\frac{\\sum_{s \\in S} s^2}{\\sum_{p \\in P} p^2} \\end{displaymath}", "How do I have a camera follow my object in Unity? I have an object that automatically moves by itself and I want the main camera to automatically follow it.(Like in games such as geometry dash and jetpack joyride) This is the code for the automatic moving object in case it is needed: using UnityEngine; using System.Collections; public class automove : MonoBehaviour { public static int movespeed = 5; public Vector3 userDirection = Vector3.right; public void Update() { transform.Translate(userDirection * movespeed * Time.deltaTime); } } So does anyone know any good scripts I could add to the main camera to follow this object that automatically moves? Thanks in advance!", "No grub menu after Ubuntu install, booting directly into Ubuntu", "How to customize my titlepage? The standard titlepage is quite simple. I am looking for a very and need help customizing my title page. It should match the classicthesis doctoral thesis template Below a minimal working example: \\documentclass[12pt,a4paper,footinclude=true,twoside,headinclude=true]{scrbook} \\XeTeXinputencoding iso-8859-1 \\usepackage[marginparsep=8pt,left=3.5cm,right=3.5cm,top=3cm,bottom=3cm]{geometry} \\usepackage[parts,pdfspacing,dottedtoc]{classicthesis} \\frontmatter \\begin{document} \\pagestyle{scrheadings} %this is the place to set up my cover sheet. %******************************************************* % Abstract %******************************************************* %\\renewcommand{\\abstractname}{Abstract} \\pdfbookmark[1]{Résumé}{Résumé} \\begingroup \\let\\clearpage\\relax \\let\\cleardoublepage\\relax \\let\\cleardoublepage\\relax \\chapter{Résumé} Résumé de la thèse en français\\dots \\vfill \\chapter*{Summary} Résumé de la thèse en anglais\\dots \\endgroup \\vfill \\end{document}", "Problem For what natural numbers is $n^3 &lt; 2^n$? Attempt @ Solution For $n=1$, $1 &lt; 2$ Suppose $n^3 &lt; 2^n$ for some $n = k \\ge 1$ It looks like the inequality is true for $n = 0$, $n = 1$ and $n\\ge10$ But, how can I prove this through induction?", "Prove that if $A$ is an infinite set then $A \\times 2$ is equipotent to $A$ I want to prove that if $A$ in an infinite set, then the cartesian product of $A$ with 2 (the set whose only elements are 0 and 1) is equipotent to $A$. I'm allowed to use Zorn's Lemma, but I can't use anything about cardinal numbers or cardinal arithmetic (since we haven't sotten to that topic in the course). I read a proof of the fact that if $a$ is an infinite cardinal number, then $a+a=a$, which is something similar to what I want to prove. Any suggestions will be appreciated :)", "How do you remove duplicates from a list whilst preserving order? Is there a built-in that removes duplicates from list in Python, whilst preserving order? I know that I can use a set to remove duplicates, but that destroys the original order. I also know that I can roll my own like this: def uniq(input): output = [] for x in input: if x not in output: output.append(x) return output (Thanks to for that .) But I'd like to avail myself of a built-in or a more Pythonic idiom if possible. Related question:", "QGIS 3.4 : Add points to exact locations? I would like to add several coordinates at specific British National Grid Easting and Northing values. I know this can be done by bringing in a .csv, but I want to know is there a way to manually enter the numbers in QGIS 3.4, and then the point moves to that location ? I've read that in QGIS 2.x there was a plugin called Numerical Vertex Editor that doesn't seem to exist for 3.x ?", "In viewing the weekly list of rep change, I see on top: razpeitia2 5 16 member for: 2 years, 7 months link #1 week rank +8529 change 727 total reputation 2,286 week reputation How can someone with 727 total have 2286 for the week with no bounties? Call me curious. Is this a bug or something else here?" ]

[ "3-regular graphs with no bridges Problem. Use Tutte's 1-factor theorem to prove that every 3-regular graph with no bridges has a 1-factor. I honestly have no idea how to approach this problem. I have drawn a couple of graphs to gain some insight to no avail. Any hints or tips will be greatly appreciated.", "How do I allow long URLs to have line breaks at any point. This is in the bibliography not the main text. I am trying to save space so don't want extra spaces to be added to make it only break at slashes, for example, as it does by default. I am using biblatex+biber.", "Assume $f:A\\to A'$ is a function, $B\\subset A'$, $C\\subset A'$, and $f^{-1}(B\\cap C)=\\emptyset$ How can we see that $f^{-1}(B)\\cap f^{-1}(C)=\\emptyset$?", "The add comment link and comment box overlaps bounty box The following you could have seen in (sorry, I've commented there, so you won't see it anymore) in Chrome 35.0.1916.153 m (current version). Notice how the add comment link overlaps the bounty box: The same you can observe with a comment box on other sites, e.g. at this time in : Could you shift it a bit down ? It seems that it happens on more than just Stack Overflow (maybe all sites ?).", "for normal user I get : /usr/lib/lightdm/lightdm:/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/usr/local/games:/home/monty/google_appengine which is actually the content of /etc/environment For root I get: /usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin what's the reason behind this and which file contains this line?", "From a collection of short stories I read at least 30 years ago. :/ This is going to be incredibly vague, so apologies in advance. A human and alien (blob/octopus-like...I think) from warring races are captured by an unidentified higher intelligence and put in an enclosure (more like a zoo habitat rather than a prison cell). They are separated by an invisible barrier and can see each other. I think they were both trying to escape or trying to figure out how they could kill the other first. There was a bulldozer/loader type vehicle they could use at one point to build a shelter (or something). I believe they were crafting makeshift weapons as well. There was no communication between the two as far as I remember. The main tension in the story seemed to be was the race to get to the other first. This has been stuck in my head forever. I know its a very common theme. The short stories may have included Asimov.", "What, exactly, is transferred along supply lines? Supply routes are great when a settlement is just starting out to get things off the ground, but what is specifically transferred along them? I know anything on the Junk, Aid and Mods tabs are transferred, and Fusion cores and Power Armor pieces aren't. Does that mean weapons, armor and ammo aren't transferred at all? And what about Food and Water resources? Can I build a farming community with a surplus of food and use that to feed a merchant-only settlement, or are local crops always required? Ditto water.", "Can a dual national visit USA under VWP after visa refusal for other nationality? Recently I was refused an E-2 visa under Section 214b. To be honest I don't really know why because I have strong ties with my home country (house, bank account, family) so my lawyer sent an appeal to the legalnet and I'm waiting for an answer. I have a second nationality that I used to travel in USA within the last 15 months under ESTA. A few days after my E-2 refusal I checked my ESTA status and it is still authorized. Can I travel to the States right now or not? I have a purchased business over there and have to take care of my assets.", "Open Mapping Theorem: counterexample The Open Mapping Theorem says that a linear continuous surjection between Banach spaces is an open mapping. I am writing some lecture notes on the Open Mapping Theorem. I guess it would be nice to have some counterexamples. After all, how can you appreciate it's meaning without a nice counterexample showing how the conclusion could fail and why the conclusion is not obvious at all. Let $\\ell^1 \\subset \\mathbb{R}^\\infty$ be the set of sequences $(a_1, a_2, \\dotsc)$, such that $\\sum |a_j| &lt; \\infty$. If we consider the $\\ell^1$ norm $\\|\\cdot\\|_1$ and the supremum norm $\\|\\cdot\\|_s$, then, $(\\ell^1, \\|\\cdot\\|_1)$ is complete, while $(\\ell^1, \\|\\cdot\\|_s)$ is not complete. In this case, the identity $$ \\begin{array}{rrcl} \\mathrm{id}:&amp; (\\ell^1, \\|\\cdot\\|_1)&amp; \\to &amp;(\\ell^1, \\|\\cdot\\|_s) \\\\ &amp; x &amp; \\mapsto &amp; x \\end{array} $$ is a continuous bijection but it is not open. I want a counterexample in the opposite direction. That is, I want a linear continuous bijection $T: E \\to F$ between normed spaces $E$ and $F$ such that $F$ is Banach but $T$ is not open. This is equivalent to finding a vector space $E$ with non-equivalent norms $\\|\\cdot\\|_c$ and $\\|\\cdot\\|_n$, such that $E$ is complete when considered the norm $\\|\\cdot\\|_c$, and such that $$ \\|\\cdot\\|_c \\leq \\|\\cdot\\|_n. $$ The Open Mapping Theorem implies that $\\|\\cdot\\|_n$ is not complete. So, is anyone aware of such a counterexample?", "I have used the websites of SO a lot the past few months because I am busy with a large scale web project. I feel I get better answers here on SO than when I just do a Google search, maybe because I can be more specific here with my problem, and the responses are really fast. Occasionally when I am not working I try to answer some questions, but the question almost always has an answer which is 'as good as' or 'better' than the answer I would supply. So my question/answer ratio is about 20/1 something, if not more. When I look at my profile page I see a bucket-load of questions and almost nothing I answered myself. Is this considered bad behaviour? I can see that this looks a little egoistic. : One devoted to one's own interests and advancement.", "How do I use multirow in LaTeX? How do I code a table to look like this? I'm not the best at LaTeX and can't seem to wrap my head around \\multirow. I checked other examples prior to posting but they used \\multicolumn and it just confused me even more. Thanks in advance! \\begin{center} \\begin{tabular}{ |c|c|c|c|c|} \\hline TextA &amp; TextB &amp; TextC &amp; TextD &amp; TextE\\\\ \\hline A &amp; TextF &amp; TextG &amp; TextH &amp; TextI\\\\ B &amp; TextJ &amp; TextK &amp; TextL &amp; TextM\\\\ C &amp; \\multirow{2}*{TextF} &amp; TextG &amp; TextH &amp; TextI\\\\ \\cline{3-3} &amp; TextJ &amp; TextK \\\\ \\hline \\end{tabular} \\end{center} I was trying something like this.. I'm starting to have problems as I'm trying to multirow within a multirow? I'm not sure of the process here. I would like TextG to be split into 2 and TextH and TextI to be the cells which are split in 3 but not sure how to go about it. Will then TextJ and TextK be the contents of the split TextG cell?", "Can someone show me a straightforward proof that $\\lim_{m\\to\\infty}(1+\\frac{r}{m})^{mt}=e^{rt}$ Thanks!", "Why is $\\Gamma\\left(\\frac{1}{2}\\right)=\\sqrt{\\pi}$?", "Validity of conditional statement when the premise is false.", "I bought two pieces of land. One from Morthal, and one from Falkreath. Morthal was the first plot of land I purchased. I only finished half of it. I bought the plot of land in falkreath because I liked the nature better. I finished the house completely in Falkreath. Every time I try to adopt a child off the streets it keeps saying \"I have a place but no room for you\" Even though I have the bedrooms in my Falkreath house. Why can I not adopt a child and have him/her live at my house in Falkreath?", "A new Victorian-set British novel begins sentences containing h-dropping with lower-case e's, as in \" 'e took my money, 'e did.\" This seems incorrect but I'm at a loss to find the rule.", "Showing that every field is an integral domain.", "How to fix Footnote position at the bottom of the page \\footnote[1]{\\nameref*{8.1.16} is an अधिकार सूत्र it goes upto \\nameref*{8.3.55}} \\&amp; अङ्गाधिकार (अङ्गस्य)\\footnote[2]{\\nameref*{6.4.1} is an अधिकार सूत्र it goes upto \\nameref*{7.4.97}} I am using footnote as shown above. However the footnote appears to be floating and when I don't have much in the page it appears in the middle of the page. I got by so far with \\vspace{} but I think there must be a way to position this at the bottom of the page despite whats in the page. Thanks for your help", "gain admin access to sql express 2008", "how to install the DDE to the ubuntu 20.04? I have installed the Ubuntu 20.04, and want now I want to install Deepin Desktop Environment (dde) My steps are: add the ppa and install using apt sudo add-apt-repository ppa:leaeasy/dde sudo apt-get update sudo apt install dde But during the command sudo add-apt-repository ppa:leaeasy/dde I get the following error: $ sudo add-apt-repository ppa:leaeasy/dde You can install deepin desktop environment by run sudo add-apt-repository ppa:leaeasy/dde sudo apt-get update apt-get install dde ------ Ubuntu Bionic: https://drive.google.com/file/d/1xkQPb4tWocknuYeY-t41W--kz-9SSL0V/view?usp=sharing ------ Important Issue: Q: Can dde on Ubuntu 16.04? A: Sorry, the dde depends on qt version above than 5.6. If you want to install dde, please upgrade to 17.04 or above. More info: https://launchpad.net/~leaeasy/+archive/ubuntu/dde Press [ENTER] to continue or Ctrl-c to cancel adding it. Hit:1 http://in.archive.ubuntu.com/ubuntu focal InRelease Hit:2 http://in.archive.ubuntu.com/ubuntu focal-updates InRelease Hit:3 http://in.archive.ubuntu.com/ubuntu focal-backports InRelease Ign:4 http://ppa.launchpad.net/leaeasy/dde/ubuntu focal InRelease Hit:5 http://security.ubuntu.com/ubuntu focal-security InRelease Err:6 http://ppa.launchpad.net/leaeasy/dde/ubuntu focal Release 404 Not Found [IP: 91.189.95.83 80] Reading package lists... Done E: The repository 'http://ppa.launchpad.net/leaeasy/dde/ubuntu focal Release' does not have a Release file. N: Updating from such a repository can't be done securely, and is therefore disabled by default. N: See apt-secure(8) manpage for repository creation and user configuration details. I get the similar error with sudo apt-get update : $ sudo apt-get update Hit:1 http://in.archive.ubuntu.com/ubuntu focal InRelease Hit:2 http://in.archive.ubuntu.com/ubuntu focal-updates InRelease Hit:3 http://in.archive.ubuntu.com/ubuntu focal-backports InRelease Ign:4 http://ppa.launchpad.net/leaeasy/dde/ubuntu focal InRelease Hit:5 http://security.ubuntu.com/ubuntu focal-security InRelease Err:6 http://ppa.launchpad.net/leaeasy/dde/ubuntu focal Release 404 Not Found [IP: 91.189.95.83 80] Reading package lists... Done E: The repository 'http://ppa.launchpad.net/leaeasy/dde/ubuntu focal Release' does not have a Release file. N: Updating from such a repository can't be done securely, and is therefore disabled by default. N: See apt-secure(8) manpage for repository creation and user configuration details. How can I install dde ?" ]

[ "I'm using the gnome flashback session with metacity window manager, but I can't change to any metacity theme in any of the tweaking tools, as they're not even appearing in the lists. Is there anything I can do?", "\"What more\" vs \"what else\" do you need? I am providing you with food, shelter, clothes. What more do you need or what else do you need? Which one's correct?", "How exactly does one “control for other variables”? Here is the article that motivated this question: I liked this article, and it nicely demonstrates the concept of “controlling for other variables” (IQ, career, income, age, etc) in order to best isolate the true relationship between just the 2 variables in question. Can you explain to me how you actually control for variables on a typical data set? E.g., if you have 2 people with the same impatience level and BMI, but different incomes, how do you treat these data? Do you categorize them into different subgroups that do have similar income, patience, and BMI? But, eventually there are dozens of variables to control for (IQ, career, income, age, etc) How do you then aggregate these (potentially) 100’s of subgroups? In fact, I have a feeling this approach is barking up the wrong tree, now that I’ve verbalized it. Thanks for shedding any light on something I've meant to get to the bottom of for a few years now...!", "In X-Men Origins: Wolverine, Wolverine is shot through the head with what appears to be a vibranium bullet by William Stryker. He remarks that the brain will grow back but the memories won't. So the projectile penetrated the adamantium skull and damaged the brain. Adamantium is an inorganic substance. It will survive anything that would otherwise destroy the rest of Wolverine's body. But if anything (such as vibranium) manages to damage the adamantium, it is not covered by Wolverine's healing abilities. Does this mean that Wolverine has an Achilles' heel on his forehead? If so, how did he take a bullet to the exact same spot in X-Men: United (at Ice Man's home)?", "Which one is correct: '3 hour journey' or a '3-hour journey'? Which one of the following is correct (bold part)? It took us quite a long time to get here. It was 3 hour journey. or It took us quite a long time to get here. It was a 3-hour journey.", "Are both of the following sentences correct? a: You can call me, if you need me. OR b: You can call if you need me. Note that in a:, the comma is placed before the \"if\" and is not present in case b. From this link, I gather that it isn't necessary because it's a short sentence: But can someone point out an \"official\" source on this usage?", "Changing Date format and appending to original file I have file like this called a.txt: [2016-03-30T04:51:51.599-04:00]!ER_DEV!Port_Conflict!/u05/app/ [2016-01-20T04:30:21.885-04:00]!ER_DEV!Port_Conflict!/u05/app/ I need to modify it so it looks like: 2016-03-30 04:51:51!ER_DEV!Port_Conflict!/u05/app/ 2016-01-20 04:30:21!ER_DEV!Port_Conflict!/u05/app/ i already wrote a command to change [2016-03-30T04:51:51.599-04:00] to 2016-03-30 04:51:51 .but how to append the query output to original file. awk -F'!' '{print $1}' a.txt | awk -F '[T.]' '{print $1 \" \" $2}' | awk '{gsub(/\\[/,\"\")}1'", "# and ## in macros", "Prior to the spell cast on Mjolnir, did Thor control lightning on his own? In the film Thor, Odin casts a spell on Mjolnir and strips Thor of his power. He then banishes Thor to Midgard (Earth). On Earth, Thor is seemingly just a strong and durable human. Later in the film, he becomes worthy, and regains control of Mjolnir. This then grants him his full power set and control over Mjolnir. My question is, prior to this, could Thor control lightning all on his own? Or is this purely an ability of Mjolnir?", "What's the source of \"shipped\" in a romantic sense?", "Can't plot with gnuplot on my Mac I am trying to plot with gnuplot on my Mac (OS X 10.8.5). I have installed X11 and XQuartz 2.7.4 and after that I installed gnuplot, but unfortunately gnuplot couldn't plot. Simple plots like the following fail to render and have no error message to help understand what is amiss: [1/10/13 $gnuplot &gt;plot sin(x)", "Java - Splitting a CSV file into an Array", "What's the difference between an Application, a Process, and a Service?", "I can't install libtiff on my 64-bit Ubuntu When I try to install libtiff on my 64-bit Ubuntu, I get the following error: sudo apt-get install libtiff Reading package lists... Done Building dependency tree Reading state information... Done Package libtiff is not available, but is referred to by another package. This may mean that the package is missing, has been obsoleted, or is only available from another source E: Package 'libtiff' has no installation candidate ubuntu@ip-10-119-97-123:/mnt$ libtiff-memcached libtiff-memcached: command not found", "Can't install Ubuntu 18.10 on XPS 15 - EFI\\BOOT\\mmx64.efi not found I tried to install Ubuntu 18.10 on my XPS 15 9570 earlier. Everything was working fine until I got to the partition selection part of the installation. That's when the installer crashed and I had to shut down my machine. I think it's because I had my SATA configuration set to RAID ON instead of AHCI, which is now fixed. Now when I try to run the installer from my bootable USB I get the following error Failed to open \\EFI\\BOOT\\mmx64.efi - Not Found Failed to load image \\EFI\\BOOT\\mmx64.efi: Not Found Failed to start MokManager: Not Fond Something has gone seriously wrong: import_mok_state() failed Hoping someone might have some idea as to what is going on", "Should the currently selected item in a combo/dropdown box also be included in the list of choices? For example, you have a combo box which contains 10 elements including the one that is currently selected. When you prompt to drop down the list to choose another, should the currently selected item also be in this list?", "I have a file: Base.h class Base; class DerivedA : public Base; class DerivedB : public Base; /*etc...*/ and another file: BaseFactory.h #include \"Base.h\" class BaseFactory { public: BaseFactory(const string &amp;sClassName){msClassName = sClassName;}; Base * Create() { if(msClassName == \"DerivedA\") { return new DerivedA(); } else if(msClassName == \"DerivedB\") { return new DerivedB(); } else if(/*etc...*/) { /*etc...*/ } }; private: string msClassName; }; /*etc.*/ Is there a way to somehow convert this string to an actual type (class), so that BaseFactory wouldn't have to know all the possible Derived classes, and have if() for each one of them? Can I produce a class from this string? I think this can be done in C# through Reflection. Is there something similar in C++?", "How do I change my default browser? Is there an option to change my default browser for all my applications?", "I know that both can mean \"inside\" but what I don't have clear is whether both mean the same when talking about time. For example: The party is in two days = The party is within two days ?? According to this link within means a limit that can be exceeded, so I'm wondering too if say \"the party is within two days max\" is correct or redundant.", "$(n^2 - 1)!$ is a multiple of $(n!)^n$ Question: Find all positive integers $n$ such that $(n^2 - 1)!$ is a multiple of $(n!)^n$. I can show that the required condition fails if $n$ is a prime, and by direct computation, it also fails for $n=4$. After doing a few small examples by hand, I believe that the required answer is 1 and all composites greater than 4. However, I cannot seem to prove this. For each prime $p&lt;n$, I tried to count the number of appearances of $p$ on both sides, but I get that I am supposed to compare $n(\\lfloor{\\frac{n}{p}} \\rfloor + \\lfloor{\\frac{n}{p^2}} \\rfloor +\\dots)$ against $\\lfloor{\\frac{n^2-1}{p}} \\rfloor + \\lfloor{\\frac{n^2-1}{p^2}} \\rfloor + \\dots$, which is not obvious to compare. Any help will be gretaly appreciated." ]

[ "The identification of an electron as a particle and the positron as an antiparticle is a matter of convention. We see lots of electrons around us so they become the normal particle and the rare and unusual positrons become the . My question is, when you have made the choice of the electron and positron as particle and anti-particle does this automatically identify every other particle (every other fermion?) as normal or anti? For example the proton is a particle, or rather the quarks inside are. By considering the interactions of an electron with a quark inside a proton can we find something, e.g. a conserved quantity, that naturally identifies that quark as a particle rather than an antiparticle? Or do we also just have to extend our convention so say that a proton is a particle rather than an antiparticle? To complete the family I guess the same question would apply to the neutrinos.", "Stack Overflow in ES, PT, RU, JP have mixed-language descriptions", "How do I check where devices are mounted? What is the command that lets me see what and where devices are mounted? I'm having trouble changing songs on my old iPod, and I have a feeling it's because of the mount point.", "Partial instead of full markers are shown in PGFplots When using \\documentclass{article} \\usepackage{pgfplots} \\begin{document} \\begin{tikzpicture} \\begin{axis} \\addplot [ red, solid, mark=x, domain=-3e-3:3e-3, samples=50 ] {exp(-x^2/(2e-3^2))/(1e-3*sqrt(2*pi))}; \\end{axis} \\end{tikzpicture} \\end{document} the markers look fine, see , but when I replace solid with, for instance, loosely dashed, so \\documentclass{article} \\usepackage{pgfplots} \\begin{document} \\begin{tikzpicture} \\begin{axis} \\addplot [ red, loosely dashed, mark=x, domain=-3e-3:3e-3, samples=50 ] {exp(-x^2/(2e-3^2))/(1e-3*sqrt(2*pi))}; \\end{axis} \\end{tikzpicture} \\end{document} the markers only show partially instead of fully, see . How can I use loosely dashed with full markers showing?", "I was asked this question in an interview. Lets say we have a correlation matrix of the form \\begin{bmatrix}1&amp;0.6&amp;0.8\\\\0.6&amp;1&amp;\\gamma\\\\0.8&amp;\\gamma&amp;1\\end{bmatrix} I was asked to find the value of gamma, given this correlation matrix. I thought I could do something with the eigenvalues, since they should be all greater than or equal to 0.(Matrix should be positive semidefinite) - but I don't think this approach will yield the answer. I am missing a trick. Could you please provide a hint to solve for the same?", "I'm trying to find the probability of getting 8 trials in a row correct in a block of 25 trials, you have 8 total blocks (of 25 trials) to get 8 trials correct in a row. The probability of getting any trial correct based on guessing is 1/3, after getting 8 in a row correct the blocks will end (so getting more than 8 in a row correct is technically not possible). How would I go about finding the probability of this occurring? I've been thinking along the lines of using (1/3)^8 as the probability of getting 8 in a row correct, there are 17 possible chances to get 8 in a row in a block of 25 trials, if I multiply 17 possibilities * 8 blocks I get 136, would 1-(1-(1/3)^8)^136 give me the likelihood of getting 8 in a row correct in this situation or am I missing something fundamental here?", "Fisher's exact test on 2x4 table I am working on 4 different plants. I have the (RNA-Seq) data from sequencing. I look for two events E1 and E2, say, at certain positions in their genome. Let's say E2 is the common one and E1 is a special event. The positions I look for are identical across all 4 (in the genome). And let's say I see that the observation I have for 1 particular position is: P1 P2 P3 P4 E1 0 20 0 17 E2 100 80 100 120 Here, P1 through P4 refers to plants and E1 and E2 refers to the events. E2 is more common. So, my objective is to actually check if E1 occurs more often in one or more plants than in the others. If they occur at the same proportion in all, of course it is not interesting to me. I have 2 questions: (I have already asked before but didn't get an answer) Will a fisher test be right for this problem? I hypothesize (Null) that the proportion of E1 is not different in occurrence between the 4 plants. Now, I set out to find if the proportion I have here is by any means significantly different. I use R, fisher.test() and I get p-value=2.5e-10. So, I reject my Null hypothesis for this case because I find strong evidence against it. Sometimes, I have an observation like this, P1 P2 P3 P4 E1 0 20 0 17 E2 0 80 0 120 then fisher.test() gives me a p-value of 0.147. So, I don't reject the Null hypothesis. However, from a biological point of view, I would consider this significant. However fisher test answers the question I originally asked. I guess the proportion 0/0 for P1 and P3 are not useful (or not used). So, my question is: Is it possible to modify the test such that it is sensitive even if E1 and E2 are 0 in 1 or more plants for a particular observation? Having thought a bit to frame this post, I guess, in that case I have to ask a different question.", "How to check whether a JavaScript variable defined in cross-browser way? I ran into this problem when writing some JavaScript utilizing FireBug logging. I wrote some code like below: function profileRun(f) { // f: functions to be profiled console.profile(f.constructor); f(); console.profileEnd(f.constructor); } It works fine in FireFox/FireBug, but it reports error in IE8 RC1. So, I'd like to do some checking whether console variable exists in the execution environment. Below code works fine in FireFox, but not in IE8 RC1. function profileRun(f) { if (console != undefined) { console.profile(f.constructor); } f(); if (console != undefined) { console.profileEnd(f.constructor); } } However, if I do it this way. It works in IE8 RC1. Why? function profileRun(f) { if (window.console != undefined) { console.profile(f.constructor); } f(); if (window.console != undefined) { console.profileEnd(f.constructor); } } Is there any cross-browser way to check it?", "Let $X$ be a space that satisfies the hypotheses used to construct a universal cover $\\overline{X}$. Let $\\pi = \\pi_1(X)$ and consider the action of the group $\\pi$ on the space $\\overline{X}$ given by the isomorphism of $\\pi$ with $\\text{Aut}(\\overline{X})$. Let $A$ be an abelian group and let $\\mathbb{Z}[\\pi]$ act trivially on $A$, $a \\cdot \\sigma = a$ for $\\sigma \\in \\pi$ and $a \\in A$. Now, assume that $X$ is a CW complex. How do I see that $\\overline{X}$ is a CW complex such that the action of $\\pi$ on $\\overline{X}$ induces an action of the group ring $\\mathbb{Z}[\\pi]$ on the cellular chain complex $C_*(\\overline{X})$ such that each $C_q(\\overline{X})$ is a free $\\mathbb{Z}[\\pi]$-module and$$C_*(X; A) \\cong A \\otimes_{\\mathbb{Z}[\\pi]} C_*(\\overline{X})?$$", "I have two lightning component placed on one page lightning app. First Component have refresh icon and I set onclick action to refresh Component $A.get('e.force:refreshView').fire(); but this event refresh the whole page instead of First component. how can refresh only one component on page not all the page ?", "I have a Red Hat Enterprise Linux server (7.5 x86_64). I have OpenSSH version 7.4. I was asked to upgrade it to a later version for security reasons: Nessus states that . However the Red Hat software and downloads does not have the latest package RPM. I found some clues on where to get the latest package for OpenSSH. I found , however, I do not know on how to upgrade it and trust this website. I do not want the SSH and other configuration to be modified by the ugrade. I did find links but however they are not useful, for example . I would like to know how to upgrade OpenSSH without using yum.", "Let $R$ be a commutative ring with 1 then why does $a\\in N(R) \\Rightarrow 1+a\\in U(R)$? Let $R$ be a commutative ring with 1, we define $$N(R):=\\{ a\\in R \\mid \\exists k\\in \\mathbb{N}:a^k=0\\}$$ and $$U(R):=\\{ a\\in R \\mid a\\mbox{ is invertible} \\}.$$ Could anyone help me prove that if $a\\in N(R) \\Rightarrow 1+a\\in U(R)$? I've been trying to construst a $b$ such that $ab=1$ rather than doing it by contradiction, as I don't see how you could go about doing that.", "Cannot install Ubuntu in VirtualBox due to \"this kernel requires an x86-64 CPU, but only detects an i686 CPU, unable to boot\" error I was trying to install Ubuntu 12.04 in VirtualBox 4.2.12r84980. I see this kernel requires an x86-64 CPU, but only detects an i686 CPU, unable to boot But I am using a 64 bit Windows 8, and trying same .iso for trying Ubuntu. Then what is the problem?", "Greets This is exercise 15.d chapter 3 of Stein &amp; Shakarchi's \"Complex Analysis\", they hint: \"Use the maximum modulus principle\", but I didn't see how to do the exercise with this hint rightaway, instead I knew how to do it with the Casorati-Weiestrass Theorem, here is my answer: Define $g(z)=f(1/z)$ for $z\\neq{0}$,then by the hypothesis we must have that for any $\\epsilon&gt;0$ $g(D_{\\epsilon&gt;0}(0)-\\{0\\})$ is not dense in $\\mathbb{C}$, then the singularity at $0$ of $g$ is not essential, this implies $f$ must be a polynomial, but if $f$ is a non-constant polynomial, it is easy to see that its real part must be unbounded, so $f$ must be constant. I would like to know an answer with the the maximum modulus principle. Thanks", "What is a decoupling capacitor (or smoothing capacitor as referred to in the link below)? How do I know if I need one and if so, what size and where it needs to go? mentions many chips needing one between VCC and GND; how do I know if a specific chip is one? Would an 4-bit parallel access shift register used with an Arduino need one? (To use my current project as an example) Why or why not? I feel like I'm starting to understand the basics of resistors and some places they're used, what values should be used in said places, etc, and I'd like to understand capacitors at the basic level as well.", "Does the (relativistic) mass change? Why? I learned recently that when an object moves with a velocity comparable to the velocity of light the (relativistic) mass changes. How does this alteration take place?", "Using lasso for feature selection, followed by a non-regularized regression I use Lasso logistic regression in order to identify a smaller subset of important variables. I start with N=51 (28/23) and 32 predictors. So far it looks pretty promising, because I can identify four important predictors in my optimal model. Now I would like to take those four predictors and examine them along with some control variables in a standard logistic regression. My question is, does that analysis strategy make sense? Is there a better way to include controls or other variables that might be interesting? For a better understanding: Identify important variables via Lasso logistic regression Do further analysis including identified predictors and other control variables using standard logistic regression (using AIC to check model fit)", "I want to put some symbols in green color with lstdefinelanguage in latex, but it seems that symbols are not recognized. The symbols I need to be colored are =, > and &lt;. Is it possible? How can I do this? The main file: \\documentclass{article} \\usepackage{graphicx,color} \\usepackage{booktabs} \\usepackage{listings} \\lstdefinelanguage{NeoIDL}{ sensitive = true, keywords = [1]{module, resource, enum, annotation, for, import, entity, path, @get, @post, @put, @delete, require, ensure, otherwise, call}, %ndkeywords={int, \\char{} }, %ndkeywordstyle=\\color{blue}\\bfseries, morekeywords=[2]{&gt;, &lt;, ==}, keywordstyle=[2]\\color{green}, numbers=left, numberstyle=\\scriptsize, stepnumber=1, numbersep=8pt, showstringspaces=false, breaklines=true, frame=top, comment=[l]{//}, morecomment=[s]{/*}{*/}, commentstyle=\\color{purple}\\ttfamily, stringstyle=\\color{red}\\ttfamily, morestring=[b]', morestring=[b]\" } \\begin{document} \\begin{figure}[htb] \\begin{small} \\lstinputlisting[language=NeoIDL,firstnumber=1]{store_pos_servico.neo} \\end{small} \\caption{Service 1} \\end{figure} \\end{document} The file to be formatted: module store { (...) resource order { path = \"/order/{id}\"; @post int postOrder (Order order) require (call store.getOrder(id) == \"NotFound\"), otherwise \"InvalidPrecondition\" }; }", "Is an empty set equal to another empty set?", "Proving a function is Lipschitz continuous Show that the following function is Lipschitz continuous and find a Lipschitz constant $$y\\mapsto f(x,y)\\\\ f(x,y)=\\frac{y}{x}\\ln(\\frac{y}{x})\\text{ , } |x-1|\\leq\\frac{1}{2}\\text{ , } |y-e|\\leq\\frac{e}{2} $$ I have no clue on where to begin to prove this. My first question is how I should interpret this function, is $x$ a sort of constant?" ]

[ "How to make Unicode charset in cmd.exe by default?", "Changing content of footline in beamer How is it possible to set a specific text in the footline of the slides in beamer? In my case, author names and the title are shown. Instead I'd like to show the conference name and country. \\documentclass{beamer} \\usetheme{CambridgeUS} \\author{Elena Piper, Amina Shahid, April Fiorese} \\title{Evaluating the Change of Performance Metrics for Key ABS} \\begin{document} \\maketitle \\end{document}", "How to sort a list of objects based on an attribute of the objects?", "Example images in LaTeX? How to make an example image in LaTeX, a dummy image, a spot holder? I have seen it before, but I can't remember how they would made. It would be nice to be able to use example images - if you should help anyone or you need to question in this community. You might say I could , but I tried - and are obviously too stupid to find anything. \\documentclass[12pt,a4paper]{article} \\usepackage[utf8]{inputenc} \\usepackage[ngerman, danish]{babel} \\usepackage[T1]{fontenc} %\\usepackage[]{} \\begin{document} \\iffalse \\begin{figure} \\includegraphics[scale=1]{•} \\end{figure} \\fi \\end{document} Is it also possible to resize the example image? So I need a usepackage to make an image without including an immage. An placeholder so anyone can try my code without needing images - just needing my tex-code. I hope you understand? Kind regards!", "Java is one of my programming languages of choice. I always run into the problem though of distributing my application to end-users. Giving a user a JAR is not always as user friendly as I would like and using Java WebStart requires that I maintain a web server. What's the best way to distribute a Java application? What if the Java application needs to install artifacts to the user's computer? Are there any good Java installation/packaging systems out there?", "Counting points in shapefile within polygons of another shapefile using ArcGIS Desktop? I'm creating a map with two shapefiles: A polygon of counties Points of cities I used the function Intersect to group the cities in each county. I'm trying to get the number of cities in each county to show up in the legend. For example, in county A there are 16 cities, in county B there are 7 cities and so on. I'm trying to create a choropleth map that shows the number of cities in each county.", "The covid19 death data for US shows strong periodic trends. It does not make sense to me that people die periodically. What could be the reason to having such data? I thought it might be the reporting artifacts, for example, people always update data at Monday, but the period seems to be 3-4 days.", "How do I remove the proprietary ATI drivers? I've installed 11.10 and the proprietary ATI drivers using \"additional drivers\" The performance of my system is absolutely awful and it shouldn't be. I tried to remove the proprietary drivers using the Additional Drivers tool and it appears to remove them. However after I reboot I cant get back into my desktop properly (the panel and launcher go missing). This doesn't seem to be an isolated problem in 11.XX. covers how to restore the desktop (panel and launcher), but the guide doesn't fix my problem though. Whenever I do sudo unity --reset it runs through its normal processes until it hangs at setting update \"run_key\" and never gets past that. I must reinstall the proprietary drivers using jockey-text or jockey-gtk in order to get back to my proper desktop. Interestingly enough the system performance seems improved while it is in its \"broken\" state (missing panel and launcher). I think restoring the default drivers may solve my problems but I cant figure out how to do it.", "Connecting to sql server database mdf file without installing sql server on client machine?", "passthrough graphics card to virtualbox So I'm trying to get my laptops NVIDIA fx 880m to pass to a virtual box running window seven on a linux mint 17 install. So far everything seems to be (maybe) heading in the right direction: the device passed through happily, when I booted the virtual box it installed a bunch of new drivers, but when I try to install the NVIDIA driver on the guest it can't find the card. I looked under the device manager and there's no listing for the nvidia card under the pci bus, my guess would be that I need to disable it in the host so that it can be passed through to the guest (the virtual box manual said they can't be shared) but I'm not sure how to do so. Can anybody help with this? This question does not seem to me to be a duplicate of , because here the given solution was that it was not possible with a windows host, however in this case the host is linux", "How to select top 10 records from each category", "Construction of a Borel set with positive but not full measure in each interval", "How to enable bullet points when using the presento beamer theme? I have the problem that when I use an itemize list and the , there are no bullet points. Here is a minimal working example (requires the not available on CTAN to be downloaded first): \\documentclass{beamer} \\usepackage{config/presento} \\begin{document} \\begin{frame} \\begin{itemize} \\item ... \\item ... \\item ... \\end{itemize} \\end{frame} \\end{document} How to fix this problem?", "A proof using Yoneda lemma", "Should the weight of downvotes be increased?", "The Half-Elven and their choices", "Can I turn off macOS Catalina's internal display without close the lid while using an external monitor?", "Why is the Sun approximated as a black body at ~ 5800 K?", "There are two Java Web Start tags: : x 239 : x 320 Both tags refer to the same technology refers to both wiki point to all questions tagged with clearly relate to Java Web Start I suggest they be merged into (which appears in the auto-complete list if one types \"webstart\" in the Tags box when asking a new question).", "Selenium python drop down menu select" ]

[ "String answer1 = \"yes\"; if (answer1 == \"yes\") gives false. Why?", "Ok. So I read books as a kid, this may have been mid to late 1980s. Definitely before 1993. These details I remember, they might be from the same book or from several: Slower than light space travel with severe time dilation. There were boardings of space ships, but the fighting odds could be very uneven because a foe could be from your future or your past, depending on when you started your space journey, because of relativistic time dilation. No faster than light travel, no time travel either. Just regular physics. To fight better in melee, soldiers would have (more or less willingly, I think they knew beforehand) false memories or notions implanted of the enemy as horrible human beings so soldiers could kill them more easily without remorse. Towards the end of the story, veterans of the war are described as not quite feeling at home after the war. One planet (home?) or country is described as inhabited entirely of clones, Adams and Eves, I think homosexual, or that sexuality could be switched deliberately. I think the veterans find at the end a refuge somewhere more like the home they are used to. The reason so much has changed is of course the time dilation. They spent maybe decades in the war, while on the planets centuries or millenia passed. I think one moral (there may be many more I missed as a child) of the story was the futility of war. If I recall correctly, the war was resolved in a way that made the efforts of the veterans seem for nothing.", "Does Qt have a C interface?", "Variables losing their values", "What is the correct way to completely remove an application? I've searched the net for such information and found different command lines, like these ones: sudo apt-get remove application sudo apt-get remove application* sudo apt-get remove --purge application sudo apt-get remove --purge application* sudo apt-get purge application sudo apt-get purge application* So, what is the correct way? Is it necessary to use that \"*\"? After that, I also found these commands: sudo updatedb sudo locate application sudo rm -rf (file/folder name)", "How do I make Units efficiently? I just blew almost all my money on a really cool lookin' ship. How do I regain solvency without spending a lot of time fiddling around in my inventory? At the moment I've found a sequence of steps that'll turn 50 carbon and 100 Plutonium into ~5000 Units (by creating Suspension Fluid and then turning it into Electron Vapor). Are there better recipes or sequences of recipes I should look for? Or should I just drop the whole thing and go mine a particular mineral?", "Custom Layout in android", "Prove $f $ is identically zero if $f(0)=0$ and $|f'(x)|\\le|f(x)|$", "Parse JSON using Python?", "Light is clearly affected by gravity, just think about a black hole, but light supposedly has no mass and gravity only affects objects with mass. On the other hand, if light does have mass then doesn't mass become infinitely larger the closer to the speed of light an object travels. So this would result in light have an infinite mass which is impossible. Any explanations?", "Generalised rule for verb usage in simple present tense using participle", "I installed Windows on my computer, followed by an installation of Ubuntu. However, now I'm unable to boot into my Windows install. What can I do to fix this?", "\"It is they who lied\" or \"it is them who lied?\" Which is the correct usage of the third person, plural pronoun? It is they who lied. It is them who lied.", "How about a \"Irritable\" badge for someone who downvotes often? EDIT : How about a forced comment dialog...which forces the user's to comment when they downvote otherwise they can't....right now it just shows a popup to suggest posting a comment...maybe this is little too strict...but i just find it annoying when ppl downvote and leave no comments.... How about having a badge \"Irritable\" for a user who downvotes over 20 times in a month and then have maybe further \"Furious\" for over 50 downvotes in a month....just a fun suggestion...since i see people downvote like crazy at times...there should also be a way to downvote a comment i think in addition...", "On a series involving harmonic numbers", "When approximating a posterior using MCMC, why don't we save the posterior probabilities but use the parameter value frequencies afterwards?", "Why can't I import a file in the init.m file?", "Avoiding if statement inside a for loop?", "IOS 5.1.1 Safemode problem I jailbroke my old iPod Touch 3rd Generation, with IOS 5.1.1, using the latest version of absynthe. It worked for several months, but then it randomly stopped. It went into safe mode, but the touch screen wouldn't work. It showed the lockscreen, but nothing worked at all, except for the physical buttons. The only way to reboot is to follow the same steps as DFU mode (Hold power button 3 sec, then home button AND power for 10, then just home for 8)... However, it always boots right back into Safe mode. I had to restore, and once rejailbroken, it worked fine, until I installed SBsettings. Then it did the EXACT same thing, and I had to restore and re-jailbreak AGAIN! The other day, I finished installing ALL of my extensive list of tweaks, and got it to about where I wanted it, when lo and behold, it booted to safe mode again. I have spent so much time on this, and I do not want to do it again. Does anybody here have any knowledge on the topic? Is there a program I can run from my computer to manually control the device or kick it out of safe mode? Is there some other method of doing this? I am looking for any solution OTHER than restoring. I have done that several times. Also, I know the problem isn't with my jailbreak. It worked for several months before, then one day stopped. Now, it has the problem within a day of rejailbreaking, OR instantly if I install SBsettings. I re-installed the jailbreak, and applied the new one as well, and that didn't work. I have given up, and don't want to go through the painful process of restoring, rejailbreaking, and re-installing all of those tweaks again. Also, because I can't get into my iPod, I can't provide a list of tweaks. I would if I could, but it just can't happen unless I can get in there.", "What's the easiest way to run GUI apps on Windows Subsystem for Linux as of 2018? I searched around, and currently there are two methods suggested; installing an enhancement for Windows Subsystem for Linux and installing an XServer. I want to know which method is the most hassle-free (easy to install AND to use), and which one is less memory-heavy. I just want Synaptic and CMake. Why couldn't that be a builtin feature?" ]

[ "Task manager for Ubuntu", "How do I get a bigger static scrollbar (aka normal scrollbar)?", "What is the difference between a gameplay programmer and a game designer/developer?", "Check if a services is installed using C", "Can all real polynomials be factored into quadratic and linear factors? So I understand how to do integration on rational functions with a linear and a quadratic denominator, and I understand how to do a partial fraction decomposition, but I was wondering what happens if the polynomial is higher degree and can't be factored. Later in the page, it says this: However, it can be shown that any polynomial with real coefficients is a product of linear and/or irreducible quadratic factors with real coefficients. And I was wondering, how do we know this and is this definitely true?", "Why is sample standard deviation a biased estimator of $\\sigma$?", "1N5819-E3/73 1N5819-E3/53 1N5819-E3/54 the first one is 4x cheaper than the last, why ? aren't they all the same ?", "Can US stocks list on one stock exchange but trade on other US stock exchanges? I am trying to understand how the US stock market works. From my understanding, there is one stock exchange where a company is &quot;listed&quot;. This stock exchange listing requires the company to adhere to the regulations of the stock exchange where it is listed. Once a company is &quot;listed&quot;, its shares can start to trade on any stock exchange. For example, once a company lists on NASDAQ, its shares can be traded on NASDAQ, NYSE, Boston Stock Exchange, Philadelphia Stock Exchange, National Stock Exchange, EDGX Exchange, EDGA Exchange, NYSE Arca, etc. Is my understanding correct? Is it true that once a stock is listed on a US stock exchange, the stock can then trade on any US stock exchange? Consider the Level 2 quotes for Microsoft (NASDAQ: MSFT). Microsoft is only listed on NASDAQ, but it also trades on the NYSE and other stock exchanges: My questions are: Does this mean that companies only need to be listed on one stock exchange in order for their stock to trade on other stock exchanges? If so, do companies need to adhere to the &quot;listing requirements&quot; of all the stock exchanges where their stock is traded, even though they are not &quot;listed&quot; on those stock exchanges? Does Microsoft have to follow the listing requirements of the NYSE even though it is not listed there? If stocks can trade on any US stock exchange regardless of which US stock exchange the stock is listed on, why don't NYSE-listed companies reduce their yearly listing fees by listing on NASDAQ instead?", "Finding the limit of $(1-\\cos x)/x^2$ $$\\lim _{x \\to 0}{1-\\cos x\\over x^2}={2\\sin^2\\left(\\frac{x}{2}\\right)\\over x^2}={\\frac{2}{x^2}\\cdot {\\sin^2\\left(\\frac{x}{2}\\right)\\over \\left(\\frac{x}{2}\\right)^2}}\\cdot\\left(\\frac{x}{2}\\right)^2$$ now $$\\lim_{x \\to 0}{\\sin^2\\left(\\frac{x}{2}\\right)\\over \\left(\\frac{x}{2}\\right)^2}=\\left({\\sin\\left(\\frac{x}{2}\\right)\\over \\left(\\frac{x}{2}\\right)}\\right)^2=1^2$$ So we have $$\\frac{2}{x^2}\\cdot \\left(\\frac{x}{2}\\right)^2=\\frac{2}{x^2}\\cdot \\left(\\frac{x^2}{4}\\right)=\\frac{1}{2}$$ Are the moves right?", "Title, section headings disappears when I use \\usepackage{forest} with IEEE Access template When I include a \\usepackage{forest} all colored text title, section headings disappears with IEEE Access journal template How can I tackle this problem?", "In the PGF/TikZ manual, sometimes I see the option right of=somenode instead of right=of somenode. They look very similar, but the effects are different. The distance between nodes positioned with the latter option is boundary-to-boundary, as stated in the manual. However, with the first option, it seems that the distance is shorter. I couldn't find any explanation of the first option in the manual. My question is: what is the difference between the two options? Is there any explanation in the manual that I missed?", "How to use early stopping properly for training deep neural network?", "Can I look at the upgrade log after a distribution upgrade? I've upgraded to Ubuntu 12.04 and did it . I didn't look at the \"packages to remove\" section before clicking next - I've done Ubuntu upgrades many times and assumed it was just the normal set of obsolete library packages etc. But I do tend to watch the terminal text go by and see what it's doing, and I saw it removing a number of packages I wanted. I guess these are packages that aren't on the CD that can't co-exist with the new Ubuntu. Anyway, I want to find which packages have been removed. So does the update log get saved somewhere? Then I can start doing some grepping on it and then reinstall the packages I did want.", "Query to list number of records in each table in a database", "How to search entire hard drive for a file?", "How do I set the proper exposure for nighttime moon photos? All my attempts to get a good shot of the full moon with my DSLR result in an overexposed circle on a black background. I've tried using a tripod, remote shutter release, low ISO, and long exposure, but nothing has worked so far. What combination of ISO and exposure time that will produce good results? I particularly want to catch a full moon with the reddish effect when it is close to the horizon.", "If $f,g$ are continuous at $a$, show that $h(x)=\\max\\{f(x),g(x)\\}$ and $k(x)=\\min\\{f(x),g(x)\\}$ are also continuous at $a$ If $f,g$ are continuous at $a$, show that $h(x)=\\max\\{f(x),g(x)\\}$ and $k(x)=\\min\\{f(x),g(x)\\}$ are also continuous at $a$. Here is my attempt at a proof. It feels very elaborate and I am not sure if it is correct. Can someone please point out any mistakes or places where I may improve. Thanks! By the definition of continuity at $a$ of $f,g$ we have that $\\lim\\limits_{x\\to a}f(x)=f(a)$ and $\\lim\\limits_{x\\to a}g(x)=g(a)$. Suppose that $f(a)&gt;g(a)$. Then there exists a $\\delta&gt;0$ such that $f&gt;g$ for all $x$ satisfying $|x-a|&lt;\\delta$. Then for $x$ satisfying $|x-a|&lt;\\delta$ we have $h(x)=f(x)$ and $k(x)=g(x)$ and thus $h$ and $k$ are continuous at $a$ because $f$ and $g$ are continuous at $a$. Now if $f(a)&lt;g(a)$ we simply relabel $f=\\tilde{g}$ and $g=\\tilde{f}$, so that $\\tilde{f}(a)&gt;\\tilde{g}(a)$ and we apply the previous result to show that again $h$ and $k$ are continuous at $a$.\\ Now if $f(a)=g(a)$ then we can distinguish three cases. $f\\geq g$ in a small neighborhood about $a$, $f\\leq g$ in a small neighborhood about $a$ or $f\\geq g$ on one side of $a$ and $f\\leq g$ on the other side. In the first case we assume that $f\\geq g$ in some small neighborhood about $a$. Then, since $f(a)=g(a)$ we have $h(x) = f(x)$ in this neighborhood and $k(x) = g(x)$ and again we see that $h$ and $k$ are continuous at $a$ due to the continuity of $f$ and $g$ at $a$. Similarly if $f\\leq g$ in a neighborhood around $a$ then $h(x)=g(x)$ and $k(x)=f(x)$ in this neighborhood and $h$ and $k$ are continuous at $a$. Suppose that just to the left of $a$ we have $f\\geq g$ and just to the right of $a$ we have $f\\leq g$. Then $\\lim\\limits_{x\\to a^-}h(x)=\\lim\\limits_{x\\to a^-}f(x)=f(a)=h(a)=g(a)=\\lim\\limits_{x\\to a^+}g(x)=\\lim\\limits_{x\\to a^+}h(x)$. Similarly $\\lim\\limits_{x\\to a^-}k(x)=\\lim\\limits_{x\\to a^-}g(x)=g(a)=k(a)=f(a)=\\lim\\limits_{x\\to a^+}f(x)=\\lim\\limits_{x\\to a^+}k(x)$. So $\\lim\\limits_{x\\to a}h(x)=h(a)$ and $\\lim\\limits_{x\\to a}k(x)=k(a)$ which means that $h$ and $k$ are continuous at $a$. Lastly if $f\\leq g$ just to the left of $a$ and $f\\geq g$ just to the right of $a$ we can relabel $f=\\tilde{g}$ and $g=\\tilde{f}$ and apply the last result to show $h$ and $k$ are continuous at $a$. Again, please point out any mistakes I may have made. Thanks!!", "Is Pikachu's gender ever confirmed? I was recently having a discussion about Pokémon, and it came up that none of us were sure whether Ash's Pikachu in the series was male or female. Some (myself included) always thought it was male, whereas others could've sworn it was female. Was there ever any canon evidence to point in one direction or another?", "Gaps between arrows and labels", "Are there any synonyms for the noun 'crush'? I must clarify, when I say 'crush', I mean the subject of an unrealistic, one-sided infatuation. For example, it can be used in this sentence: 'My celebrity crush is David Beckham.' Could that word be interchanged for another? Preferably, can it be a word which is not necessarily too formal/complex? I've searched online for a while but can't find any synonyms for this form of 'crush.' I want the word for a novel which is set in an old-ish fantasy period so I don't think 'crush' would feel in-place. The main character is a lower-class worker." ]

[ "SSL certificate for a public IP address?", "Maybe a stupid question but how can I tell if I have a static IP address or a dynamic IP address? Running Fedora-13", "Kind of a strange question, but say something has spoiled, i.e. smells bad, tastes bad, etc. Will it actually always make you sick? Like for instance spoiled dressing, let's say it tastes sour, smells nasty and you eat it, will it make you sick? If so what actually makes you sick? The toxins/bacteria? or it just being unappetizing? I ask because I tried a TINY bit of ranch and while it tasted mostly fine (it was a bit tangy) it smelled quite tangy but looked fine. I also saw .", "I haven't filed 2020 taxes yet. On my last return (2019) my adult daughter was on my return as a dependent. When I file 2020, I will not put her on my return as a dependent, because she finished college in 2019. I had her file her 2020 return early this year so she would be sure to get a stimulus check in case they did another one (I assumed they would exclude adult dependents as they had with previous stimulus payments). Today, she got the $1,400 deposited to her account by the Treasury. However, I was surprised to see $4,200 deposited to my account, when I expected only $2,800 (for me and my wife). They paid for my daughter twice, $1,400 to her (based on her 2020 return) and $1,400 to me (based on my 2019 return that showed her as a dependent). They have the social security numbers, so I assumed the IRS and Treasury would have figured this out. I have searched and searched, but am unsure whether this overpayment will be clawed back or not. I can't even find a mechanism for returning it (and getting credit for doing that if they later do say I owe it to them). I've read if your 2019 income made you eligible, but your 2020 income (if you file after the stimulus) would have made you ineligible, they won't claw back the stimulus they sent. Stimulus money for people that died between the tax return and the stimulus disbursement does have to be returned to the treasury. I can't find guidance for our situation. There must be a fair number of people with college kids that have the same scenario. This question seems at first to ask the same thing, but it doesn't include the key point of overpayment by the Treasury.", "How does a graduate program's admissions committee operate? How does a typical graduate program's admissions committee operate? (In the US --- I understand that in Europe admissions are often structured differently.) My mental model at the moment is several professors sitting in a conference room with a stack of printed applications and a few piles: accept, maybe, and reject. Three or so professors will read an application and then make a decision. If the volume of applications is large enough, multiple meetings might be required. This is purely my imagination --- I don't know how accurate this model is. Of course, I'm sure that how admissions are handled depends greatly on the school, program, and department. I'm interested in a few data points to get a rough idea of what the average is. A few more specific related questions: How much time does a typical committee spend on each application? I suspect there's a distribution. Obviously unqualified applicants will probably have their applications tossed into the reject pile pretty quickly. Qualified applicants' applications might receive more attention. Do admissions committees look online for more information about an applicant? I've read some professors (in CS --- not my field) will look at a student's research/project website, but I have no idea how common this is.", "Aware abbreviating those commands need not always be helpful, I would like to know how to abbreviate them? The following is what I tried, which does not work: \\documentclass[11pt,handout]{beamer} \\newcommand{\\bframe}{\\begin{frame}} \\newcommand{\\eframe}{\\end{frame}} \\newcommand{\\ftitle}{\\frametitle} \\author{Author} \\title{Title} \\begin{document} \\maketitle \\begin{frame} \\frametitle{Outline} \\end{frame} \\bframe \\ftitle{Introduction} \\eframe \\end{document} At first I thought it might be the case that commands such as \\bframe was already defined. But using \\def instead still gives no desired result.", "Functional equations leading to sine and cosine", "I am writing pseudo code in the algorithmic environment. It is quite long and doesn't fit on one single page. Instead of it continuing on the next page, it is cut off. I tried inserting it into a figure environment, but the problem persists. Is there a solution to have the code continue on the next page?", "If space of bounded operators L(V,W) is Banach, V nonzero, then W is Banach (note direction of implication) Let $V,W$ be normed vector spaces, and $L(V,W)$ be the space of bounded linear operators. Usually I would only see the statement \"If $W$ is Banach, then $L(V,W)$ is Banach.\". But writes that there is a converse: \"If $L(V,W)$ is Banach, and if $V$ is non-trivial, then $W$ is Banach\". This is pretty interesting since I never seen a converse before. I was wondering if anyone has a nice proof. I tried reversing the proof for the usual direction, but the inequalities can't be reversed. I also tried to start with a Cauchy sequence in $W$, and construct linear operators (using Hahn-Banach to control the operator norms), but alas I cannot say much about the distance between these operators (much less say that it is Cauchy)", "av_acharya@AnoxBotox:/$ wireshark qt.qpa.plugin: Could not find the Qt platform plugin &quot;xcb&quot; in &quot;path/to/plugins&quot; This application failed to start because no Qt platform plugin could be initialized. Reinstalling the application may fix this problem. sudo apt-get install --reinstall qt5-default Reading package lists... Done Building dependency tree Reading state information... Done The following NEW packages will be installed: qt5-default 0 upgraded, 1 newly installed, 0 to remove and 23 not upgraded. Need to get 0 B/24.4 kB of archives. After this operation, 170 kB of additional disk space will be used. Selecting previously unselected package qt5-default:amd64. (Reading database ... 241279 files and directories currently installed.) Preparing to unpack .../qt5-default_5.12.8+dfsg-0ubuntu1_amd64.deb ... Unpacking qt5-default:amd64 (5.12.8+dfsg-0ubuntu1) ...", "Careers ads break the Android app Clicking any Careers (or Jobs) ad in the Android app feed results in an instant crash for the Android App version 1.0.89.", "Proving $|P(A\\cap B)-P(A)P(B)|\\leq \\frac{1}4$ Let $A$ and $B$ be two events of a probability space. Prove that $\\displaystyle|P(A\\cap B)-P(A)P(B)|\\leq \\frac{1}4$ I think it's a very challenging problem, and I've made no progress so far ... Can someone give me a hint ?", "How to handle relative urls correctly with a nginx reverse proxy Sure I'm not the first one that tried to serve a domain example.com from a example.net/bbb, but I haven't found a solution yet. My NGINX configuration follows the and looks something like this: server { listen 80; server_name example.net; root /path/to/aaa; location /bbb/ { proxy_pass http://example.com/; proxy_set_header Host $host; proxy_set_header X-Real-IP $remote_addr; } location / { try_files $uri $uri/ /index.html; } location ~ \\.(svg|ttf|js|css|svgz|eot|otf|woff|jpg|jpeg|gif|png|ico)$ { access_log off; log_not_found off; expires max; } } I can manage to render the root of example.com in example.net/bbb but: ISSUE 1 example.net/bbb/some/path doesn't work as expected and the index.html of example.net is rendered. ISSUE 2 Any asset in example.com/assets gives 404 because the browser look for example.net/assets. Be great if I could solve this without placing absolute paths everywhere.", "The company I work for has asked me to attend a training class on the other side of the country. However my situation is my drivers license expired a few days ago. I do however have a separate printed email stating that the license has been renewed. This drivers license is my only ID that shows both my name &amp; photo. Is it possible to be able to board a flight with the expired drivers license and the printed email showing that it was renewed?", "Show if a user is online, idle, or offline on their account page? I want to display the status of the user on the account page. I added the following code in the theme I am using. It works, but users are never displayed offline. Why? What is wrong in the code? user.html.twig &lt;div class=&quot;bs-field-status&quot;&gt; {% if status == 'Online' %} &lt;i class=&quot;user-online fa fa-circle fa-lg&quot;&gt;&lt;/i&gt; Online {% elseif status == 'Absent' %} &lt;i class=&quot;user-absent fa fa-circle fa-lg&quot;&gt;&lt;/i&gt; Absent {% else %} &lt;i class=&quot;user-offline fa fa-circle fa-lg&quot;&gt;&lt;/i&gt; Offline {% endif %} &lt;/div&gt; bootstrap_subtheme_front_office.theme &lt;?php /** * @file * Bootstrap sub-theme. * * Place your custom PHP code in this file. */ use Drupal\\Core\\Database\\Database; /** * Implements hook_entity_presave(). */ function bootstrap_subtheme_front_office_preprocess_user(&amp;$variables) { // get user object $user = $variables['elements']['#user']; //- The user has logged in at least once if ($user-&gt;getLastLoginTime()) { if (account_is_logged_in_less_then_thirty_minutes($user-&gt;id())) { $status = 'Online'; } else { $status = 'Absent'; } } else { $status = 'Offline'; } $variables['status'] = $status; } /** * @param $uid * * @return bool */ function account_is_logged_in_less_then_thirty_minutes($uid) { $connection = Database::getConnection(); $query = $connection-&gt;select('sessions', 'sessions') -&gt;fields('sessions', ['sid', 'uid', 'timestamp']) -&gt;condition('sessions.uid', $uid, '=') //- chef if the user was online in 30 minutes (60 * 30) -&gt;condition('sessions.timestamp', \\Drupal::time() -&gt;getRequestTime() - (60 * 30), '&gt;') -&gt;execute(); //- Get result. $results = $query-&gt;fetchAll(\\PDO::FETCH_OBJ); return (count($results) &gt; 0) ? TRUE : FALSE; }", "lsusb relevant output Bus 001 Device 006: ID 0bda:8812 Realtek Semiconductor Corp. RTL8812AU 802.11a/b/g/n/ac WLAN Adapter Upon plugging the device it is recognized by lsusb, however when I go to wireless settings no adapter is recognized. The driver is installed (by going to software and updates -> addition drivers and selecting the open source driver).", "I am trying to import an Excel table with around 10,000 XY points into ArcMap 10.2. I am using State Plane NAD 1983 Alabama West (US Feet) as the Coordinate System in my map data frame. I then add the excel table to my Table of Contents in the map then select Display XY Data. Next, I choose the same coordinate system as my data frame then select OK. Once it creates the Events layer for my points they are not in the correct location. Should I switch everything in my map to WGS84 or is there a solution for my points to be added onto my current map with the state plane coordinate system?", "What does this phrase from The adventures of Tom Sawyer sentence mean: \"True, the knife would not cut anything, but it was a \"sure-enough\" Barlow, and there was inconceivable grandeur in that -- though where the Western boys ever got the idea that such a weapon could possibly be counterfeited to its injury is an imposing mystery and will always remain so, perhaps.\" Thank you!", "how to create a roster sheet in sharepoint 2010 This is about training management, when an employee requests for training, it goes to approval workflow and once approved, it is like the employee is enrolled. Once it is approved I want a roster sheet to be created for that course for all the employees registered and who got approved. The report I need to generate has to be of the enrolled users of one course and one particular session If I give copy listitem as approved then different courses would come together in the list The format for the report", "How to use \"fit\" to frame the nodes and labels I'm using the fit TikZ library to fit a rectangle around two nodes which include labels. However, the rectangle is only fit around the actual nodes, not about their labels: \\documentclass{article} \\usepackage{tikz} \\usetikzlibrary{fit} \\begin{document} \\begin{tikzpicture} \\node [label=label1,draw] (node1) {Node1}; \\node [label=label2,draw] (node2) at (4,2){Node2}; \\node[fit=(node1)(node2), draw] {}; \\end{tikzpicture} \\end{document} How to fit the rectangle also around the node labels?" ]

[ "How is the /tmp directory cleaned up? Is it automatic? If so, how frequently is it cleaned up?", "Polynomial irreducible - maximal ideal I have a couple of ideals which I wonder if I correctly classify as maximal/prime ideal. $I_1 = \\langle 2x^2 + 9x -3\\rangle$, $I_2 = \\langle x - 1\\rangle$ $\\mathbf 1)$ Is $I_1$ a maximal ideal in $\\mathbb{Q}[x]$? Yes, since $I_1$ is irreducible with $p=3$ using Eisenstein's criterion, thus maximal ideal. $\\mathbf 2)$ Is $I_2$ a prime ideal in $\\mathbb{Q}[x]$? Yes, since $I_2$ is obviously irreducible, and thus a maximal ideal, and every maximal ideal is a prime ideal. $\\mathbf 3)$ Is $I_2$ a maximal ideal in $\\mathbb{Z}[x]$? Yes, $I_2$ is obviously irreducible, and thus a maximal ideal. $\\mathbf{Edit:}$ No, as it is not a field. $$ $$ Am I right in my conclusions? Appreciate any help.", "Ubuntu 16.04 sftp and vscode ssh not working", "In a 2D top-down game, how can I create projectiles that have a height?", "$\\lim_{n \\rightarrow\\infty} ~ x_{n+1} - x_n= c , c > 0$ . Then, is $\\{x_n/n\\}$ convergent?", "How to make a cross-module variable?", "Silverlight - how do I get the text of the selected item in a combobox", "How to reorder /etc/resolv.conf at load time I have a CentOS system that retrieves its upstream DNS servers via DHCP. I want to run DNSMasq on this box and use it as a server to resolve some hostnames for development. The problem is when my system starts, the upstream DNS servers are loaded into /etc/resolv.conf and THEN the DNS1 entry from my ifcfg-enp0s3 setup gets loaded. That's a problem because when I query for the internal dev names, it tries to go out to the upstream DNS server instead of checking DNSMasq first. I need the DNSMasq server to be at the TOP of the /etc/resolv.conf and the dhcp loaded ones at the bottom of the resolv.conf so that DNSMasq will work properly. Any simple way to do that?", "Show that $u(x)=\\ln\\left(\\ln\\left(1+\\frac{1}{|x|}\\right)\\right)$ is in $W^{1,n}(U)$, where $U=B(0,1)\\subset\\mathbb{R}^n$. The entire problem statement is: Let $n&gt;1$ and let $U=B(0,1)\\subset\\mathbb{R}^n$. Show that $u:U\\to\\mathbb{R}$ given by $$u(x)=\\ln\\left(\\ln\\left(1+\\frac{1}{|x|}\\right)\\right)$$ is in $W^{1,n}(U).$ My attempt at the proof is as follows: To show that $u\\in W^{1,n}(U)$ it suffices to show that $|Du|\\in L^{n}(U)$. Consider $$u_{x_i}=\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{1+\\frac{1}{|x|}}|x|^{-2}\\frac{x_i}{|x|},$$ which simplifies to, $$u_{x_i}=\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{1+\\frac{1}{|x|}}\\frac{x_i}{|x|^3}.$$ Thus, $$|Du|=\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{1+\\frac{1}{|x|}}\\frac{1}{|x|^2}$$ which can be manipulated to, $$|Du|=\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{1+|x|}\\frac{1}{|x|}.$$ Moreover, since $U=B(0,1)$ we can bound the second term from above which gives, $$|Du|\\leq\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{|x|}$$ Thus, we can instead show that $$\\int_U\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{|x|}\\right)^n&lt;\\infty.$$ Converting this into polar coordinates we have with $r=|x|$, $$\\int_0^R\\int_{\\partial B(0,r)}\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{r}\\right)}\\frac{1}{r}\\right)^n\\,dSdr=\\int_0^R\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{r}\\right)}\\frac{1}{r}\\right)^n\\int_{\\partial B(0,r)}dSdr$$ Note that $\\int_{\\partial B(0,r)}\\,dS=n\\alpha(n)r^{n-1}$, which is the surface area of $B(0,r)$. Thus, we have then $$n\\alpha(n)\\int_0^R\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{r}\\right)}\\frac{1}{r}\\right)^nr^{n-1}\\,dr=n\\alpha(n)\\int_0^R\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{r}\\right)}\\right)^n\\frac{1}{r}\\,dr$$ And so this is where I get stuck in the problem, since I don't how I can evaluate that last integral to show it's finite. Thank you for any help or feedback!", "says: Note that there is one axiom for every such predicate φ; thus, this is an axiom schema. To understand this axiom schema, note that the set B must be a subset of A. Thus, what the axiom schema is really saying is that, given a set A and a predicate P, we can find a subset B of A whose members are precisely the members of A that satisfy P. By the axiom of extensionality this set is unique (Emphasis added) My question is why, by the axiom of extensionality, is this set unique? The Axiom of Extensionality is about set equality; what is the relation between the Axiom of Extensionality with uniqueness of this set?", "I have been playing with Ubuntu for a few weeks now, and I'd like to revert my computer back to it's original - factory - defaults. On the computer I have a recovery partition (it's a netbook). I went through the process of recovery and everything seemed fine. However, when I restart the computer I'm presented with grub rescue &gt; Now, my understanding is that when I installed Ubuntu \"side by side\" it replaced the MBR or something like it, with GRUB. I've read on a slew of forums, that I need to use a Windows Recovery Disk. Here are my issues: a) I don't have a recovery disk, I have a recovery partition - it's a netbook. b) I don't have an external cd drive. What I do have is a USB key that has about 1gb of space on it. Thanks in advance.", "Why taking components of a component of a vector is invalid?", "I have two submit buttons in a form. How do I determine which one was hit serverside?", "access parent object in javascript", "Sometimes I have asked a question which got no answers, but is answered in the comments to the question. How should I handle these questions? I can't accept an answer, so it is never an accepted question. For example this one: (ok here the answer in the comments is from me, but nevertheless I also have others of them)", "Proof of a formula involving Euler's totient function: $\\varphi (mn) = \\varphi (m) \\varphi (n) \\cdot \\frac{d}{\\varphi (d)}$ The third formula on the states that $$\\varphi (mn) = \\varphi (m) \\varphi (n) \\cdot \\dfrac{d}{\\varphi (d)} $$ where $d = \\gcd(m,n)$. How is this claim justified? Would we have to use the Chinese Remainder Theorem, as they suggest for proving that $\\varphi$ is multiplicative?", "How to avoid being prompted for a password by sudo? I know I can become root (super user) via the su command but I have to authorize it after entering the commands. Is there a way I can become root and authorize (with password) in one line", "Test of whole distribution for two samples", "How to detect if a function is called as constructor? Given a function: function x(arg) { return 30; } You can call it two ways: result = x(4); result = new x(4); The first returns 30, the second returns an object. How can you detect which way the function was called inside the function itself? Whatever your solution is, it must work with the following invocation as well: var Z = new x(); Z.lolol = x; Z.lolol(); All the solutions currently think the Z.lolol() is calling it as a constructor.", "I couldn't find much on the new Lucene-based search, and don't know much about the engine in general, so I'm asking this question. Does anybody have a description of how search results are ranked? Does the rank calculation include: rep of post's author? views? unique referers? PageRank of referers? rank of questions that link to the post? whether a question is closed? vote count? answer count?" ]

[ "Using conjugates to find a limit with a cubic root: $\\lim_{h\\to 0}\\frac{\\sqrt[3]{h+1}-1}{h}$ I currently have $$\\lim_{h\\to 0}\\frac{\\sqrt[3]{h+1}-1}{h}$$ Now, I know that when you have square root instead of a cubic root it's easy. You just multiply by the conjugate and simplify afterwards. If it were a sqrt I know that the limit is 1/2. I know that the result here is 1/3 but I can't seem to get there. I always end up with 1/4 due to getting something like: $$\\frac{h+1-1}{h(\\sqrt[3]{h+1}+1)(\\sqrt[3]{h+1}+1)}$$ After simplifying and evaluating the limit you end up with $$\\frac{1}{(\\sqrt[3]{0+1}+1)(\\sqrt[3]{0+1}+1)}$$ which turns out to be $1/4$. What am I doing wrong?", "How do I SOSL across objects, matching all records with FIND clause?", "Options for object creation are greyed out I am trying to model a tree. I turned on the Add a sapling add-on in user preferences, however once I want to begin editing the settings, they come up but is grey and doesn't let me click on it. I have also attached my blend file here:", "Determining ethnicity according to ancestry? My sister, cousins, and other relatives speculate that my mom's grandmother was Jewish (for various reasons). I've heard people say at times things like, for example, \"I'm 50% German\" or \"I'm 25% Swedish.\" This has to do with their ancestry. But, how exactly is this calculated? Say for example that my mother's paternal grandmother was indeed 100% Jewish, what would that make me and my siblings, and how is it calculated?", "Mysql: Select all data between two dates", "Prove that if $a+b+c$ divides $abc$, then $a+b+c$ must be composite.", "Is the total variation function uniform continuous or continuous?", "Prove that $A\\ge0, B\\ge0$ and $A\\ge B$ implies $B^{-1}\\ge A^{-1}$ Does anyone know how to prove the following: Suppose $A$ and $B$ are both positive definite and $A - B$ is positive semi-definite. Show that $B^{-1} - A^{-1}$ is also positive semi-definite. I really appreciate any comments!", "Difference between standard beta and unstandard beta distributions?", "Fixing scrolling in nano running in tmux in mate-terminal The problem: I open a terminal (in Linux Mint, so mate-terminal) zsh is the shell Then I run tmux Edit a file with nano Scroll up and down that file with the cursor Issue: When scrolling down in nano, only the bottom half of the terminal window gets refreshed Issue: When scrolling up in nano, only the top half of the terminal windo gets refreshed The complete nano view of file does not get refreshed in my terminal window when scrolling. Any tips? Edit: my .tmux.conf It seems that this line specifically is the culprit (as commenting it out fixes the problem): set -g default-terminal \"xterm-256color\" I'm pretty sure I added that line because I have issues even running nano during an SSH session. Here is the full file: set-option -g default-shell /bin/zsh # Make sure tmux knows we're using 256 colours, for # correct colourised output set -g default-terminal \"xterm-256color\" # The following were marked as \"unknown\", so # I do know what I'm doing wrong. #set -g mode-mouse on #setw -g mouse-select-window on #setw -g mouse-select-pane on # Attempting to stop \"alert\" sound upon startup # but none of these are working... set-option bell-on-alert off set-option bell-action none set-option visual-bell off", "Regex pattern to choose data BETWEEN matching quotation marks", "rake db:migrate doesn't seem to work in production", "Should an exactly equal edit be dropped? I just improved an answer which was one second later edited by another user with the same actions, so that the diff is completely empty. I think the later edit should been dropped automatically. Here is the question I'm talking about:", "How does stuff glow in the dark?", "I'm using the Webform module for Drupal 8. The module confirmation settings for a form are the following: Page (redirects to new page and displays the confirmation message) Inline (reloads the current page and replaces the webform with the confirmation message.) Message (reloads the current page/form and displays the confirmation message at the top of the page.) URL (redirects to a custom path or URL) URL with message (redirects to a custom path or URL and displays the confirmation message at the top of the page.) But how am I able to submit a form via AJAX so that the page doesn't reload on submit, but a confirmation message still replaces the form? What did I do wrong? EDIT: Here is the solution which works: First you have to hook the form alter function and set an AJAX callback (as in ): use \\Drupal\\Core\\Form\\FormStateInterface; function MYTHEME_form_alter(&amp;$form, FormStateInterface $form_state, $form_id) { if ( isset($form['#webform_id']) &amp;&amp; $form['#webform_id'] == 'MYWEBFORM' ) { // add an AJAX callback to the form submission $form['actions']['submit']['#ajax'] = array( 'callback' =&gt; '\\Drupal\\MYMODULE\\Controller\\DefaultController::processFormSubmission', 'event' =&gt; 'click', ); } } Then in the processFormSubmission function you can process the form (put use \\Drupal\\Core\\Form\\FormStateInterface; at the top of your file) like: // Instantiate an AjaxResponse Object to return. $ajax_response = new \\Drupal\\Core\\Ajax\\AjaxResponse(); /* do sth */ // in the DOM: replace the form with the text 'form submitted' $ajax_response-&gt;addCommand(new \\Drupal\\Core\\Ajax\\HtmlCommand('#MYFORM', 'form submitted')); return $ajax_response;", "I'm trying to install a Matlab R2011a launcher for Unity in Ubuntu 12.04. I've tried (although I know it's for 11.10 and mentions that even 11.10 is an unsupported OS for Matlab R2011a) but without any satisfactory solution. This is my launcher file, /usr/share/applications/matlab.desktop: #!/usr/bin/env xdg-open [Desktop Entry] Type=Application Icon=/usr/share/icons/matlab.png Name=MATLAB R2011a Comment=Start MATLAB - The Language of Technical Computing Exec=matlab -desktop Categories=Development; I open the dash panel and search for \"matlab\". This launcher is found among applications. I click it, and Matlab's splash screen shows up, but when it disappears the program doesn't start. (I've verified with htop that no matlab-processes are running in the background either.) If I add Terminal=true to the launcher file, the program starts OK, and opens a terminal as well as Matlab. However, both the terminal and Matlab itself show up in the Launcher area, with the Matlab icon, so it looks like I have two Matlab instances running when really it's only one. (Actually, they show up as two different programs, and not just two instances of the same - the icons are independent, not grouped together.) This is definitely not optimal. I had hoped to create a launcher I can lock to the launcher area, and then that same icon will be the icon for the active Matlab instance when the program is running. How do I create a launcher for Matlab that works as expected? Update: I was apparently a bit unclear on my symptoms, I'll try to clarify a little. I've also tried some suggestions from the answers, and further investigated what happens. My current setup (a launcher file with Terminal=true and Exec=matlab -desktop -nosplash &amp;) renders the following behavior: I open Dash by pressing the Windows key on my laptop, and search for \"matlab\". It finds the launcher named \"MATLAB R2011a\". I click it. A terminal window opens, using the icon I referred to in the launcher file. Almost immediately, MATLAB's splash screen also opens, using the same icon (and thus being grouped with the terminal window in the launcher). The splash screen disappears and, so does one of the icons in the launcher. The MATLAB desktop environment opens, using a different version of the icon which is displayed next to the icon for the terminal window (not grouped with it). I can lock the terminal window's icon to the launcher and successfully start MATLAB by clicking it, but it doesn't feel optimal that I start the program with one icon, and switch to it with another. I've also tried the following: Exec without the ampersand &amp; in the launcher command, but it didn't make a difference. Executing matlab -nosplash manually from a terminal still shows the splash screen. (What, then, does the nosplash option really do?)", "Restored iOS 10 with broken Home button I restarted my iPhone 6 running iOS 10 and the home button is broken, so I was using Assistive Touch. But at the first launch, Assistive Touch is disabled. On iOS 10, we have to \"Press home button to unlock\". What can I do?", "I've been battling the following two questions for more than a day today. Write a regular expression (comprised of {a, b}) that contain at least two b and do not contain abb. Write a regular expression (comprised of {a, b}) that contain abba and do not contain baa. For the first part I wrote a basic one to start off with that doesn't handle the must two-b: b* OR a* OR (a+ AND b)* OR a* I ran a few &quot;truth tables&quot; inputs over it and it seems ok. But the moment I add the requirement, things go haywire. Mostly because when pushing in those &quot;b&quot;s, you can suddenly use the OR to break things up. Same thing on the second one.... Any help would be greatly appreciated! Norah", "K out of N encryption", "In iOS 8.4.1, if a caller who has 6 numbers, calls you and you see a missed call. Then, clicking the \"i\" symbol next to the missed call showed you all the 6 numbers of the caller and the number from which he called, was indicated with blue. This helped in knowing exactly what number he called me from and I could call back on the same number. iOS 9.0.1 call log does not indicate the number the caller called from with blue (if the caller has more than one number). So, it becomes impossible to call the person back on the same number. This was one very important feature that made iOS 8 very useful. Apple has taken away a very important feature." ]

[ "How do I go about proving this? I know one method is: $\\eqalign{ \\cos (90^\\circ + \\theta ) &amp;\\equiv \\cos90^\\circ \\cos\\theta - \\sin90^\\circ \\sin\\theta \\cr &amp; \\equiv (0)(\\cos\\theta ) - (1)(\\sin \\theta ) \\cr &amp; \\equiv - \\sin \\theta \\cr} $ I'd appreciate others, particularly ones that will allow me to visualize this identity on the unit circle. Thanks alot.", "Prerequisites for AIC model comparison What are exactly the prerequisites, that need to be fulfilled for AIC model comparison to work? I just came around this question when I did comparison like this: &gt; uu0 = lm(log(usili) ~ rok) &gt; uu1 = lm(usili ~ rok) &gt; AIC(uu0) [1] 3192.14 &gt; AIC(uu1) [1] 14277.29 This way I justified the log transformation of variable usili. But I don't know if I can AIC-compare models when for example the dependent variable is different? Ideal answer would include the list of prerequisites (mathematical assumptions).", "Atheros AR9485 wifi disconnects randomly", "Failed to download repository information due to missing CDROM", "Support for hardware components How can I find out if Ubuntu supports a particular hardware component, that is, if it works in Ubuntu? I am going to put together a computer and I am choosing components. How do I know if Ubuntu supports this or that motherboard, or this or that sound card, or this or that graphics card, etc? How do I know that there is no conflict in Ubuntu between this and that hardware component? What resources are there to help with such situations? I know that there are computers with Ubuntu pre-installed and that there are for whole computers but this is not what I'm looking for. I'm looking for resources to find out support for particular hardware components and conflicts among particular hardware components.", "What is a \"static\" function in C? The question was about plain functions, not static methods, as clarified in comments. I understand what a static variable is, but what is a static function? And why is it that if I declare a function, let's say void print_matrix, in let's say a.c (WITHOUT a.h) and include \"a.c\" - I get \"print_matrix@@....) already defined in a.obj\", BUT if I declare it as static void print_matrix then it compiles? UPDATE Just to clear things up - I know that including .c is bad, as many of you pointed out. I just do it to temporarily clear space in main.c until I have a better idea of how to group all those functions into proper .h and .c files. Just a temporary, quick solution.", "Rotate group of objects over an edge", "Environment variables when run with 'sudo'", "What is the use of multiple main methods?", "How does virtualizing differ from emulation, in terms of structure? Someone told me that a virtualizing program like VirtualBox does not work like an emulator does in the sense that it doesn't emulate registers and uses the actual ones for the virtualized data that are on the CPU. Emulators must emulate the registers since they are mostly to execute software that depends on a foreign environment (e.g. a Genesis emulator needs Motorola 68000's registers and memory addresses, so developer must make these resources available as emulated registers). My main question is, how is virtualization developed? How do we enable an entire OS to run as a process in a virtual machine, but get it to run independently while still making use of the actual CPU? I only know emulation, not virtualization, so if anyone could help that'd be nice! PS: I am not asking solely what the difference is, but differences in how they run software.", "What are the different widely used RAID levels and when should I consider them? This is a about RAID levels. What are: the RAID levels typically used (including the RAID-Z family)? deployments are they commonly found in? benefits and pitfalls of each?", "How to initialize private static members in C++? What is the best way to initialize a private, static data member in C++? I tried this in my header file, but it gives me weird linker errors: class foo { private: static int i; }; int foo::i = 0; I'm guessing this is because I can't initialize a private member from outside the class. So what's the best way to do this?", "Reputation widget crash I have an issue with crashing reputation widget when it's added to the home screen. When I add it for the first time, it says \"Please login before using this widget\" (even though the app itself is logged in already). So I open the app, go back to the home screen, add the widget again and it crashes (and it's not added to the home screen). When I'll try to add it again, it says \"Please login before using this widget\" again. And then it just repeats - \"Please login...\", execute the app, crash, \"Please login...\", etc. Restart of the device didn't make any change. I have found . My set up: Stack Exchange app version: 1.0.89 Android version: 5.0.1 Device: Samsung Galaxy S4", "Output of getent group", "Example of $\\deg(fg)<\\deg(f)+\\deg(g)$ Let $R$ be an integral domain and $f,g\\in R[X_1,...,X_n]$ where $n&gt;1$. What is an example of a pair $f,g$ such that $\\deg(fg)&lt;\\deg(f)+\\deg(g)$? Moreover, I have proven that the units of $R[X_1,...,X_n]$ are just the units in $R$. (Proof is done inductively) Is it true? EDIT Even though the each term in the underlined summation is nonzero, isn't it possible that the summation is 0? Why is this impossible ?", "Vertical spacing in floats I am using a float inside the text. As I found out, using \\intextsep I could set space above and below the float and the texts. But when I am using \\setlength{\\intextsep}{5mm}, the space below the float is more than the one above it. Why they are not equal? % Preview source code %% LyX 2.0.0beta1 created this file. For more info, see http://www.lyx.org/. %% Do not edit unless you really know what you are doing. \\documentclass[english]{report} \\usepackage[T1]{fontenc} \\usepackage[latin9]{inputenc} \\setcounter{secnumdepth}{3} \\setcounter{tocdepth}{3} \\usepackage{graphicx} \\makeatletter %%%%%%%%%%%%%%%%%%%%%%%%%%%%%% LyX specific LaTeX commands. %% A simple dot to overcome graphicx limitations \\newcommand{\\lyxdot}{.} %%%%%%%%%%%%%%%%%%%%%%%%%%%%%% User specified LaTeX commands. \\usepackage{setspace} \\setlength{\\intextsep}{5mm} \\setlength{\\belowcaptionskip}{0mm} \\setstretch{2} \\makeatother \\usepackage{babel} \\begin{document} Text Text Text Text Text Text Text Text Text Text Text Text \\begin{figure}[h] \\begin{centering} \\includegraphics[scale=0.5]{\\lyxdot \\lyxdot /Pictures/fedora} \\par\\end{centering} \\caption{} \\end{figure} Text Text Text Text Text Text Text Text Text Text Text Text \\end{document}", "I have a script that does a number of different things, most of which do not require any special privileges. However, one specific section, which I have contained within a function, needs root privileges. I don't wish to require the entire script to run as root, and I want to be able to call this function, with root privileges, from within the script. Prompting for a password if necessary isn't an issue since it is mostly interactive anyway. However, when I try to use sudo functionx, I get: sudo: functionx: command not found As I expected, export didn't make a difference. I'd like to be able to execute the function directly in the script rather than breaking it out and executing it as a separate script for a number of reasons. Is there some way I can make my function \"visible\" to sudo without extracting it, finding the appropriate directory, and then executing it as a stand-alone script? The function is about a page long itself and contains multiple strings, some double-quoted and some single-quoted. It is also dependent upon a menu function defined elsewhere in the main script. I would only expect someone with sudo ANY to be able to run the function, as one of the things it does is change passwords.", "prime divisor of $3n+2$ proof I have to prove that any number of the form $3n+2$ has a prime factor of the form $3m+2$. Ive started the proof I tried saying by the division algorithm the prime factor is either the form 3m,3m+1,3m+2. Case 1: $3m$ suppose $3m$ does divide $3n+2$. That means $3mr=3n+2$ where $r$ is some integer. But we get $mr-n= 2/3$ and since $mr-n$ is an integer that's a contradiction. Thus $3m$ does not work. Case 2: $3m+1$ Same argument here Case 3: $3m+2$ By the fundamental theorem of arithmetic every integer is divisible by a prime. But not sure what to do from here.", "Prove that if $d$ divides $n$, then $2^d -1$ divides $2^n -1$ Prove that if $d$ divides $n$, then $2^d -1$ divides $2^n -1$. Use the identity $x^k -1 = (x-1)*(x^{k-1} + x^{k-2} + \\cdots + x +1)$", "Exactly half of the elements of $\\mathcal{P}(A)$ are odd-sized" ]

[ "I've just recently started playing D&amp;D 4e through the Red Box, and I am confused about how to fill in the power cards. So, take Nimbus of Holy Shielding for instance. I understand the Target and Hit components as well as the effect, but my question is about the Attack component. It reads: Attack: Wisdom vs Will. Does the mean whatever my Wisdom score is, without the modifier, is compared to the Will score of the enemy? Would I then not even have to roll a d20 to see if it works?", "EU flight compensation distance for connecting flight I recently had a flight from Valencia to London, going through Düsseldorf, cancelled. According to EU regulations there are different levels of compensation for flights below and above 1500 km in distance. I assume that this distance refers to start and end airport regardless of connection. Is this the case? I haven't found a proper definition online. Here, it would make a difference as VLC to LHR is around 1350 km, but the complete itinerary is above the 1500 km threshold.", "Why is the amount of photos that fit on one card dependent on ISO?", "Change font size of the verbatim environment I want to apply small fonts inside the Verbatim environment e.g. {\\small \\begin{Verbatim} 1 double x, y; 2 double z, w; 3 main(); 4 return 0; \\end{Verbatim}} Before the command \\small and after the closing braket } text has normal size, which is obvious but the font size should be small inside the brakets. Why is this command not applied to the environment's contents?", "Let $h$ the irreducible polynomial over $\\Bbb F_2 = \\{0, 1\\}$ $$h = x^4 +x +1$$ Let $E=\\Bbb F_2(\\alpha)$, i.e. the field $\\Bbb F_2$ extended with $\\alpha$, where $\\alpha$ is a root of $h$. How do we determine the numbers of elements in the extension $E$? Can every non-zero element in the extension be expressed in the form $(\\alpha)^n$ for some $n\\in\\Bbb N$ ? How do we find all the roots of $h$ over the extension $E$?", "Let me tell the story from the beginning: I installed Big Sur on an unsupported Mac using guidelines at Medium. In the guide it was stated that I should create a separate partition for Big Sur, and shouldn't install it on my current one. I had my SSD Called &quot;Macintosh SSD&quot; and later I created a partition named &quot;Macintosh SSD Big Sur&quot; of size 40GBs. After installation I wanted to clear the &quot;Macintosh SSD&quot; of size 80GBs(with old MacOS) and merge it with the new &quot;Macintosh SSD Big Sur&quot;. This is what I initially had after formatting partition with the old MacOS So, I used the command sudo diskutil apfs deleteContainer disk3 after which I had (free space) in /dev/disk1 I want to extend that 39.6GB partition which free space of 80,1GB but all the commands I googled do not work:(( Could you please guide me on what I should do now? Thank you in advance!", "How to make a pattern follow a stroke, path or line? Here is my MS Paint job on a real bad attempt at what I'm trying to achieve: I have access to Photoshop and Illustrator CS6, and I want to be able to draw a thick line (that is not straight) and have a pattern within the line show arrowheads within the line to indicate the direction of the line.", "Is the set $S=\\left\\{\\left(z_1,z_2\\right)\\in \\mathbb C\\times \\mathbb C:z_1^2+z_2^2=1\\right\\}.$ compact? Consider the set $$S=\\left\\{\\left(z_1,z_2\\right)\\in \\mathbb C\\times \\mathbb C:z_1^2+z_2^2=1\\right\\}.$$ Is this set compact in $\\mathbb C^2$ ? As $\\mathbb C^2$ is a finite dimensional space so a subset of it is compact if and only if it is closed and bounded. But $z_1^2+z_2^2=1$ gives $(x_1^2+x_2^2)-(y_1^2+y_2^2)=1$ and $x_1y_1+x_2y_2=0$ , where $z_1=x_1+iy_1$ and $z_2=x_2+iy_2$. But from here how I can show that the set is closed and bounded ?", "I read on here of an exercise in interviews known as validating a binary search tree. How exactly does this work? What would one be looking for in validating a binary search tree? I have written a basic search tree, but never heard of this concept.", "Difference between var = {} and var = []?", "What is Peter Quill's status after Guardians of the Galaxy Vol. 2?", "Did spacetime start with the Big Bang? I mean, was there any presence of this spacetime we are experiencing now before big bang? And could there be a presence/existence of any other space-time before the big bang?", "Unable to start XAMPP using sudo in Desktop Entry", "Why did the Star Trek writers decide Warp 10 would be infinite? From onward, has a basically cubic scale from warps 1 - 9. But then, close to warp 10, it suddenly develops its own puzzling scale, as can be seen in . In this scale, , occupying all points in the universe simultaneously and therefore effectively teleporting instantaneously. My question is why have this confusing scale? Why not have a uniform cubic scale? Was there ever any \"official\" explanation for this? Clarification: I'm looking for why the writers decided on this, not the \"in-universe\" explanation.", "If RSA is limited to 117-200 bytes or so, is that a very limited use case? Am I missing something, or is RSA very very limiting when it comes to ecrypting data when it comes to the actual message size? I have read that you can only encrypt a message of around 117 to 200 bytes in size (depending on your key size: 1024 or 2048 bits). Is this correct? If so, I think I have read people suggesting on using it for larger files. I guess they are just repeating the process many times over and over in blocks of 117 bytes?", "Norms Induced by Inner Products and the Parallelogram Law Let $ V $ be a normed vector space (over $\\mathbb{R}$, say, for simplicity) with norm $ \\lVert\\cdot\\rVert$. It's not hard to show that if $\\lVert \\cdot \\rVert = \\sqrt{\\langle \\cdot, \\cdot \\rangle}$ for some (real) inner product $\\langle \\cdot, \\cdot \\rangle$, then the parallelogram equality $$ 2\\lVert u\\rVert^2 + 2\\lVert v\\rVert^2 = \\lVert u + v\\rVert^2 + \\lVert u - v\\rVert^2 $$ holds for all pairs $u, v \\in V$. I'm having difficulty with the converse. Assuming the parallelogram identity, I'm able to convince myself that the inner product should be $$ \\langle u, v \\rangle = \\frac{\\lVert u\\rVert^2 + \\lVert v\\rVert^2 - \\lVert u - v\\rVert^2}{2} = \\frac{\\lVert u + v\\rVert^2 - \\lVert u\\rVert^2 - \\lVert v\\rVert^2}{2} = \\frac{\\lVert u + v\\rVert^2 - \\lVert u - v\\rVert^2}{4} $$ I cannot seem to get that $\\langle \\lambda u,v \\rangle = \\lambda \\langle u,v \\rangle$ for $\\lambda \\in \\mathbb{R}$. How would one go about proving this?", "Making overview with linked detailed maps in QGIS? i want to create 4-5 detailed maps, and then an overview map that has rectangles that markes the locations of the detailed maps. Best case would be if the rectangles were links to the detailed map. I have managed to make the overview and the rectangles, and think I know how to make the detailed maps one by one. The rectangles are drawn manually on the overview map. All layers that I plan on using are in the same QGIS project. The final product that I hope to create would be the overview map on the first page, followed by the detailed maps. The overview would have links to the detailed maps, click on the rectangles to open the right detailed map. Is there a way to link the detailed maps to the overview in QGIS 2.8 print composer? I'm still not sure if I'm doing something wrong, when I try to create the overview. I want it to show the extents of all of my detailed maps. Is this possible?", "I have a lightning component that displays Knowledge Articles based on Topic IDs that it is configured for. This works great so I went to create my test coverage for it and discovered that the inserted test Knowledge Articles can only ever be 'Draft' making my tests fail since the apex class only looks for 'Online'. Instead of rewriting my component I decided to overload the apex method so that when called without the status parameter it passes in 'Online' allowing my tests to pass in 'Draft' instead. However, the first method signature does not get called from the component resulting in null for the status parameter. Here is the component controller: ({ \"retrieveArticles\" : function(component, event, helper) { var action = component.get(\"c.returnArticlesWithTwoTopicIds\"); action.setParams({ mainTopicId : component.get(\"v.mainTopicId\"), secondaryTopicId : component.get(\"v.secondaryTopicId\"), limitAmount : component.get(\"v.limitAmount\") }); action.setCallback(this, function(response) { var state = response.getState(); if (component.isValid() &amp;&amp; state === \"SUCCESS\") { // handle SUCCESS } else if (component.isValid() &amp;&amp; state === \"ERROR\") { // handle ERROR } }); $A.enqueueAction(action); } }) Here is the apex class: public with sharing class KnowledgeArticleVersionCtrl { @AuraEnabled public static List&lt;KnowledgeArticleVersion&gt; returnArticlesWithTwoTopicIds(String mainTopicId, String secondaryTopicId, Integer limitAmount) { return returnArticlesWithTwoTopicIds(mainTopicId, secondaryTopicId, limitAmount, 'Online'); } @AuraEnabled public static List&lt;KnowledgeArticleVersion&gt; returnArticlesWithTwoTopicIds(String mainTopicId, String secondaryTopicId, Integer limitAmount, String status) { // build query string List&lt;KnowledgeArticleVersion&gt; articles = Database.query(query); return articles; } } Is there something about the component that would cause it to not use the first signature, the one it should match, in place of the second one, which it shouldn't match?", "Xdotool using \"DISPLAY=:0\" not works in Crontab", "How close would you have to be to the merger of two black holes, for the effects of gravitational waves to be detected without instruments? Assume two black holes in the most common size range, spiraling into each other until they merge. The event releases significant amounts of energy via gravitational waves, which warp the space-time. If the distortion is powerful enough, it would get noticed in daily life, or perhaps even detected by the proprioceptors in the human body. How close, as an order of magnitude estimate, would you have to be to the merger to perceive it like that, without any instrument?" ]

[ "I'm a C++ newbie, but I wasn't able to find the answer to this (most likely trivial) question online. I am having some trouble compiling some code where two classes include each other. To begin, should my #include statements go inside or outside of my macros? In practice, this hasn't seemed to matter. However, in this particular case, I am having trouble. Putting the #include statements outside of the macros causes the compiler to recurse and gives me \"#include nested too deeply\" errors. This seems to makes sense to me since neither class has been fully defined before #include has been invoked. However, strangely, when I try to put them inside, I am unable to declare a type of one of the classes, for it is not recognized. Here is, in essence, what I'm trying to compile: A.h #ifndef A_H_ #define A_H_ #include \"B.h\" class A { private: B b; public: A() : b(*this) {} }; #endif /*A_H_*/ B.h #ifndef B_H_ #define B_H_ #include \"A.h\" class B { private: A&amp; a; public: B(A&amp; a) : a(a) {} }; #endif /*B_H_*/ main.cpp #include \"A.h\" int main() { A a; } If it makes a difference, I am using g++ 4.3.2. And just to be clear, in general, where should #include statements go? I have always seen them go outside of the macros, but the scenario I described clearly seems to break this principle. Thanks to any helpers in advance! Please allow me to clarify my intent if I have made any silly mistakes!", "How to check if specific column exists in an Access database table", "How to parse HTML with PHP?", "find() function in python2.7.5", "How to disable Ctrl+Shift+U?", "How to add video to iphone simulator", "$X^n-Y^m$ is irreducible in $\\Bbb{C}[X,Y]$ iff $\\gcd(n,m)=1$ I am trying to show that $X^n-Y^m$ is irreducible in $\\Bbb{C}[X,Y]$ iff $\\gcd(n,m)=1$ where $n,m$ are positive integers. I showed that if $\\gcd(n,m)$ is not $1$, then $X^n-Y^m$ is reducible. How to show the other direction. Please help.", "I'm trying to draw a rounded rectangle with round \"holes\" using but I need the rectangle borders to be thick and \"holes\" borders to be thin. Is there a better way to do so than: \\begin{tikzpicture}[x=1mm, y=1mm] % Background \\fill[fill=black!10] (1.5, 1.5) rectangle (15, -15); % Fill \\fill[fill=black!2, even odd rule, rounded corners=0.5mm] (0, 0) rectangle (10, -10) (2, -2) circle[radius=1.25mm] (2, -5) circle[radius=1.25mm]; % Rectangle border \\draw[thick, rounded corners=0.5mm] (0, 0) rectangle (10, -10); % Holes borders \\draw[thin] (2, -2) circle (1.25mm); \\draw[thin] (2, -5) circle (1.25mm); \\end{tikzpicture} The result image should look like this:", "My Folders Become Hidden System Files And Access Denied? I have an external hard disk , just connected to another system and when i connected to my own computer one of my folders which contain photos become hidden system files AND all folders in it rename to same name !?!? and my access is denied ( Screenshot ) I tried to change ownership but i can't Any solution !?", "Increment Record based on field", "Why can't I press the Install button when installing applications from unknown sources?", "I am looking for a word that would describe being obsessed with the details of a larger entity such that the \"looker\" neglects to see the whole or (perhaps more importantly) the purpose of the whole. Basically, \"not seeing the big picture\". What can [more] succinctly describe this? Edit: I just found this post: . I think I want the exact opposite.", "Different seed gives different LASSO output", "Is $[0,1]$ a countable disjoint union of closed sets?", "Keeping tables/figures close to where they are mentioned Is there any package or a method to force LaTeX to keep floating environments like table and figure closer to where they are declared?", "script custom previews in a menu I want to know how to create a menu with previews for an add-on. Until now I know that this is related with the bpy.utils.preview. I'm making an add-on that appends objects from a .blend file, I know how to append objects but what I want to do is to create a menu with previews of the objects /(similar to the matcaps menu - see below), select them and then press an &quot;import button&quot; to append the object. Here's some documentation about the module: Also, as this is an add-on I don't know if I should have a def register() and a def unregister() inside this .py file as well as in the __init__.py file.", "Do Indian passport holders with UK Tier 2 need to get a tourist visa for Mexico? I'm an Indian passport holder currently resident in the UK under a Tier 2 (General) visa and planning on going to Mexico on a holiday. So I was looking into the rules on the Mexican embassy in the UK and : According to the new regulations who entered into effect on 18th, May 2016 (article 26 of the Guidelines and Requirements for Migratory Services) regarding foreign nationals visiting Mexico, holders of a valid UK visa, regardless their nationality, are not required to apply for a Mexican visa as a tourist, business (Non-Lucrative Activities) or transit visitors for a stay of up to 6 months. This regulation does not apply to British Travel Document holders. However, : PERMANENT RESIDENT IN THE UK (ILR / ILE / PERMANENT RESIDENTS) According to Mexican regulations which came into force in June 2009, Permanent residents in the United Kingdom wishing to travel to Mexico do not require a visa to enter the country as tourists or business visitors for up to 180 days and as visitors in transit for up to 30 days, regardless their nationality. So which one is correct? Are Tier 2 holders with an Indian passport allowed visa-free / visa on-arrival entry to Mexico?", "It would be nice to for . As it is, SE kind of stands out (in a not cool way):", "Minion Pro, TL2016 and LuaLaTeX", "Showing directional line symbol in ArcGIS for Desktop? Is this possible in ArcGIS to have variable number of arrows on the line to show direction? This is an ArcGIS example, where I can have fixed (1,2,3,4,5...) number of arrows and it stays the same doesn't matter what the line length is. First and last always stick to the end, doesn't help with network mapping, where there is usually the node to show. Having just one in the middle is never enough, check line at the right... No such issues with ArcView 3:" ]

[ "When should a supervisor be an author? I understand that in a lot of big-lab fields it is common for the principal investigator to append their name to a paper even if they did not write the paper, design the experiment, or collect data since they spend energy securing funding, and managing the whole lab. What about for small labs? What are the requirements for a supervisor to be included as an author on a paper, as opposed to just appearing in the acknowledgements? If you are working on your own projects independently of your supervisor, but using funding provided by your supervisor (how does this change when the funding provides resources versus just your salary), are you suppose to add them as authors or just acknowledge the source of funding?", "Applescript run from menu bar?", "What are the advantages of using the optical viewfinder over live preview to take photos on a DSLR? Forgive this novice question, I am basically a complete newbie to photography. Really, all I've ever used for most my of short life have been point-and-shoots; I've only recently started to pick up some curiosity. Anyway, from what I've gathered, reading through many of the questions, most serious photographers use the optical viewfinder as their primary tool to determine what makes a good shot. Live-preview isn't used much at all; it seems its help is to primarily set up the shot. Reading a Wikipedia article seems to confirm this view, adding that [l]ive preview in DSLRs does not typically serve as their principal means of framing and previewing before taking a photograph, with this function still being mainly performed with optical viewfinder. While initially largely a novelty feature, live-preview functionality has become more common on DSLR cameras... My questions are: What are the myriad advantages of using the viewfinder over live preview, what does it help one accomplish in achieving the goals of photography? What are some interesting ways serious photographers use live preview to take better shots they might have otherwise missed?", "$\\frac{1}{99989999} = 1.00010002000300050008001300210034005500890144... \\times 10^{-8}$ (), which includes the Fibonacci sequence $(1\\ 1\\ 2\\ 3\\ 5\\ 8\\ 13\\ 21\\ 55\\ 89\\ 144\\ldots )$. This is fascinating to me but I can't figure out how this works, and a Google search doesn't seem to reveal anything.", "Let's make the hot network questions icons clickable I would like to see the icons in the 'Hot Network Questions' right panel clickable, leading to the homepage of the site where the question comes from. It would make it more comfortable to switch to the site when you want rather to visit it than to see that specific \"hot\" question.", "If you visit a chat room attached to a beta site while logged out, the log in message is all but unreadable, being dark grey on a dark blue background. For example, visit while logged out or in private browsing mode.", "How to call shell script from php that requires SUDO?", "Most common C# bitwise operations on enums For the life of me, I can't remember how to set, delete, toggle or test a bit in a bitfield. Either I'm unsure or I mix them up because I rarely need these. So a \"bit-cheat-sheet\" would be nice to have. For example: flags = flags | FlagsEnum.Bit4; // Set bit 4. or if ((flags &amp; FlagsEnum.Bit4)) == FlagsEnum.Bit4) // Is there a less verbose way? Can you give examples of all the other common operations, preferably in C# syntax using a [Flags] enum?", "I need to convert an arbitrary amount of milliseconds into Days, Hours, Minutes Second. For example: 10 Days, 5 hours, 13 minutes, 1 second.", "How to connect portable monitor USB Type-C to graphic card with display port or hdmi", "FAQ: Migrations What are the rules on migrations: Migrations in general Migrations to public betas Migrations to private betas", "Autosegmental Representation in tikz-qtree This is what I want to achieve and this: But all I've been able to make with tikz-qtree is the following: \\documentclass[12pt,a4]{article} \\usepackage[utf8]{inputenc} \\usepackage{tipa,tikz,tikz-qtree} \\begin{document} \\begin{tikzpicture} [baseline] \\tikzset{frontier/.style={distance from root=90pt}} \\Tree [.$\\sigma$ [.O [ p ] ] [.R [.$\\mu$ a ] [.$\\mu$ : ] ] ] \\end{tikzpicture} \\begin{tikzpicture} [baseline] \\tikzset{frontier/.style={distance from root=90pt}} \\Tree [.$\\sigma$ [.O [ p ] ] [.R [.$\\mu$ a ] ] ] \\end{tikzpicture} And this: \\begin{tikzpicture}[baseline] \\tikzset{frontier/.style={distance from root=90pt}} \\Tree [.$\\sigma$ [.O [ l ] ] [.R [.$\\mu$ a ] [.$\\mu$ l ] ] ] \\end{tikzpicture} \\begin{tikzpicture} [baseline] \\tikzset{frontier/.style={distance from root=90pt}} \\Tree [.$\\sigma$ [.O [ : ] ] [.R [.$\\mu$ a ] [ l ] ] ] \\end{tikzpicture} \\end{document} Which renders: and The important part here is the linking from the leaves to more than one parent (it would be nice if I had the option of making the line dashed too). Now, pst-asr doesn't quite achieve what I want it to. It's important that I have the moras ('mu's). (Also it's a pstricks package, which means I must typeset it in DVIPSPDF.) I have tried a bit of the forest-package (especially forest-GP1), but I can't make that work as I want either. Lastly, some have recommended xyling, but I find that package very difficult to use. Any recommendations? Thanks.", "Ubuntu with spyware? Richard Stallman states that Ubuntu \"has installed surveillance code\". See: Is this true? I agree with him that \"Any excuse Canonical offers is inadequate....\".", "Why do only two sexes exist for animals? Why, from the natural selection point of view, do only two sexes exist for animals?", "What is the remainder when $2^{1990}$ is divided by $1990$? I actually do not have the basic idea on how to approach these type of questions....so please tell me a generalized method about all this too. It came in RMO, and the question is: What is the remainder when $2^{1990}$ is divided by $1990$ ?", "Where does $PATH get set in OS X 10.6 Snow Leopard? I type echo $PATH on the command line and get /opt/local/bin:/opt/local/sbin:/Users/andrew/bin:/usr/local/bin:/usr/local/mysql/bin:/usr/local/pear/bin:/usr/bin:/bin:/usr/sbin:/sbin:/usr/local/bin:/usr/X11/bin:/opt/local/bin:/usr/local/git/bin I'm wondering where this is getting set since my .bash_login file is empty. I'm particularly concerned that, after installing MacPorts, it installed a bunch of junk in /opt. I don't think that directory even exists in a normal Mac OS X install. Update: Thanks to for correcting my echo $PATH statement", "Why should the \"H\" option not be used in floats?", "During Windows installation I accidentally typed an accented name for my user name and my profile name is named after it. I already renamed my user to not have an accented character, but the profile folder is an other topic. Basically I want this because I have some applications what have a problem with the accented character. Is there a way to rename it? I know I have to make a copy from my profile, but how can I perform a relocation itself? I wouldn't like touch any other profiles on the machine just mine.", "Help me to solve this problem please.. Let $Y_{(1)}, Y_{(2)}, Y_{(3)}, Y_{(4)}, Y_{(5)}$ denote the order statistics of a random sample of size 5 from a distribution having p.d.f. $f(y) = e^{(-y)}, 0 &lt; y &lt; \\infty$, zero elsewhere. Show that $Z_1 = Y_{(2)}$ and $Z_2 = Y_{(4)} − Y_{(2)}$ are independent. Hint: First find the joint p.d.f. of $Y_{(2)}$ and $Y_{(4)}$.", "Windows 7 time issues" ]

[ "'both in terms of' or 'in terms of both'?", "How can I prohibit putting figure after the footnote? I have pretty simple LaTeX code that has a lot of figure environments, and I see the figure is inserted after the footnote. \\documentclass[10pt, onepage]{article} \\usepackage{graphics,graphicx} \\usepackage{hyperref} ... dependent code\\footnote{You should use at least JRE 1.5 or later, but I highly recommend using JRE 1.6 or later}, you can safely use the JRE 1.5 or later. \\begin{figure} \\centering \\includegraphics[width=0.5\\textwidth]{pic_install/4_configure_build_path.png} \\caption{Configuration menu} \\label{fig:config_build} \\end{figure}", "Evaluate: $$\\lim_{x\\to{0}}\\bigg(\\frac{2}{x^3}.(\\arcsin{x}-\\arctan{x})\\bigg)^{2/x^2}$$ I can just expand $\\arcsin{x}$ and $\\arctan{x}$ using their taylor expansions, but is there any other method?", "System freezes completely with Intel Bay Trail My system freezes completely at random, frequent intervals. I started to have the same problem in Ubuntu 14.04 but after recent upgrade to 16.04 there is no improvement, in fact it seems worse. When it happens, it's impossible to do anything. I've tried everything in this thread: but nothing works, I have to hard reset. I have read all the system logs and journalctl but there is never any information that could help diagnose the problem. This is a dual-boot system with Windows 10 and there's no problem there, so it's not defective hardware. My laptop has an Intel Bay Trail processor (Pentium N3540)", "GRUB Help and Reinstalling Ubuntu Recently, I installed Ubuntu 10 Netbook edition (on my netbook, yes, obvious). My battery died literally, while I was using Ubuntu. Now, when I restart the computer, it seems that GRUB has duplicated all of the entries in the MBR that pertain to the partition that houses my Ubuntu install. For example: Ubuntu ... Ubuntu ... (Recovery Mode) Ubuntu ... Ubuntu ... (Recovery Mode) Memtest ... Memtest ... Windows (Vista loader) Windows (Windows 7 starter loader) When I try to access either of the two Ubuntu instances in the boot loader it presents me with an error akin to this: ...numbers... Kernel panic ... VFS unable to mount... What I would like to do is: Wipe out grub, and Ubuntu, and then reinstall Ubuntu (I really only use it for emacs and ess for R so there's nothing in the home directory that I need to backup) How would I go about \"resetting\" my system? Or fixing the issue that I have. Thanks in advance! BEB", "We have two sets: set No.1 and set No.2 as in this picture: The observer is fixed to set No.1 . He sees set No.1 motionless and observes set No. 2 approaching with velocity 100,000 m/s. Each set has one lamp and two, so called, touchers. Each set is designed so that if both touchers are touched simultaneously the lamp is turned on otherwise it remains off. Set No. 2 is approaching set No. 1 so that each toucher in each set will be touched twice by the touchers of the other set. The observer on set No. 1 observes the distance between touchers in each set 10 meters. He thinks the lamps on set No. 1 will be turned on because touchers in it will be touched simultaneously. My question: Will the lamp on set No. 2 be turned on? How if an electrical current flowing from one toucher in a set to the other proves simultaneous touching?", "What happened to Finn's blaster at Maz Kanata's? When entering, we see that Finn has the blaster that was given to him earlier: However, when the fighting begins, Finn tells Maz that he needs a weapon and no longer has his blaster with him. It seems unlikely to have been lost in the first shots, given how it is secured across his body. Also, Han and Chewie didn't lose their weapons and they are arguably less secure. Now, when the team gets to the Resistance base, Finn again has his blaster: So where was this blaster during the battle?", "To what extent are child actors exposed to the violent aspects of the movie they perform in? Some movies feature child characters put in violent situations. This can range from crude language to extreme horror (e.g. torture, gore, etc.). As an example, and its sequel has plenty of those scenes. It looks like a paradox that children can be actors in movies that are definitely not for children. Do the directors usually try and avoid exposing the very young actors to the violence of such scenes, e.g. by clever dubbing and editing? Are there laws that require them to do so, just like there are ratings that prevent children from seeing some movies?", "Number of Pairs of Subsets Find the number of Pairs $(A,B)$ of subsets of $[n]$ such that $A ⊆ B$? I just need clarification in my thought process. My professor's wording at times can through me off. I just want to know if I am on the right track. We will have $3$ regions: 1.Outside $B$ 2.Inside $A$ 3. Inside $B$, Outside $A$ I believe the number of pairs is $3^n$ but I am not sure. Any help would be appreciated.", "Is Tolkien prejudiced against the East? In Tolkien's The Lord of the Rings series, there are generally two groups of Men. The good ones are coming from the West (Dúnedain, Men of the West), and the bad ones, the Easterlings, mostly fight under Morgoth and Sauron. Why was this so?", "Cyrillic monospaced font in XeLaTeX I've installed full TexLive 2011 using \"install-tl\" script in Ubuntu 12.04. When I was using TexLive 2009 from repositories the following file was compiled without any errors. \\documentclass{article} % XeLaTeX \\usepackage{xltxtra} \\usepackage{xunicode} % Fonts \\setmainfont{Arial} \\newfontfamily\\cyrillicfont{Arial} \\setmonofont{Courier New} % Lang \\usepackage{polyglossia} \\setmainlanguage{russian} \\setotherlanguage{english} \\begin{document} English normal. \\texttt{English monospace}. Русский обычный. \\texttt{Русский моноширинный}. % Text in Russian \\end{document} But XeLaTeX from TexLive 2011 gives this error: ERROR: Package polyglossia Error: --- TeX said --- The current roman font does not contain the Cyrillic script! Please define \\cyrillicfont with \\newfontfamily. See the polyglossia package documentation for explanation. Type H for immediate help. ... l.17 ...nglish normal. \\texttt{English monospace} . In spite of this error the output PDF is correct. The error remains if comment out \\setmonofont{Courier New}. Using Courier New as main font gives no error on normal text (without \\texttt, \\textbf and so on). Using DejaVu Sans Mono as monospaced font gives no error too. I've been searching for solution few hours but there aren't any. Maybe this is a bug in Polyglossia or Fontspec?", "When is partial differentiation commutitive Consider a function: $$f:\\mathbb R ^2\\to\\mathbb R $$ when does $$\\dfrac {\\partial f(x,t)}{\\partial t\\partial x}=\\dfrac {\\partial f(x,t)}{\\partial x\\partial t}$$ Thinking about it in terms of the limit definition of derivative, and thinking about it as taking slices of surfaces and measuring the slope on the edge, seems to be giving me the feeling that answer is always. However I have some memories of there being requirements like piecewise continuous, and smooth. What is the full set of conditions?", "Gravitational wave solutions to the Einstein field equations It is well known that general relativity predicts gravitational waves, but I would like to know how. What solution(s) to the Einstein field equations yield something which can be interpreted as a wave(-like) phenomenon?", "Generating ordered combination of numbers", "I own a Panasonic DMC-G81 (same as G80/G85) with in-body Image Stabilization. When turned on everything is just fine, but when turned off, the sensor is wobbling around in the body. When no lens attached, it's clearly visible moving about 1/2 cm in the body. I didn't find anything about it in the internet. Shouldn't the sensor be in a kind of parking position, should I worry about the sensor ? I'm not sure if that is the usual behavior, maybe someone with the same or similar body can have a look.", "Prove convergence of the sequence $(z_1+z_2+\\cdots + z_n)/n$ of Cesaro means", "How to find windows 10 activation Key Where can it be find? At activation panel i can only find option to change the activation key. The current key is not presented on this screen.", "This is a about Related: I have a question regarding capacity planning. Can the Server Fault community please help with the following: What kind of server do I need to handle some number of users? How many users can a server with some specifications handle? Will some server configuration be fast enough for my use case? I'm building a social networking site: what kind of hardware do I need? How much bandwidth do I need for some project? How much bandwidth will some number of users use in some application?", "Related: I have put a bit of commentary enumerating my confusions in parentheses I read in Black Holes and Time Warps (Kip Thorne), that quasars can generate their jets from four different processes. These all involved the accretion disk, but there was one which doesn't make quite as much sense. It was called the Blandford-Znajek process, and it involved magnetic field lines carrying current. The process was visualized in two ways. A black hole, with magnetic field lines, is spinning. In the first visualisation (viewpoint actually), the magnetic field lines 'spin' along with the black hole, and nearby plasma is anchored onto the field lines by electrical forces (where did the electrical fields come from?). The plasma can slide along the field lines but not across them (why?). Since the field lines are spinning, centrifugal forces will fling them up and down the field lines, forming jets. The other viewpoint is this, and it makes even less sense (to me that is, I haven't had a formal education in GR): The magnetic fields and the swirl of space generate a voltage difference across the field lines (Why? How?). The voltage carries current across the magnetic field lines (why are the field lines behaving like wires?). This current travels across plasma, which accelerates it, creating the jets. Now the main thing that doesn't make sense, is that magnetic field lines are behaving like wires. Why would they? I suspect the answer lies hidden somewhere in the equivalence of EM waves in different frames, but I can't think up any convincing argument from that side. If the answer involves GR equations, you don't need to solve it here (wouldn't make sense to me), but if you have to, just refer to the equation and what you did to it, along with the final result. Thanks!", "Is there a difference between foo(void) and foo() in C++ or C? Consider these two function definitions: void foo() { } void foo(void) { } Is there any difference between these two? If not, why is the void argument there? Aesthetic reasons?" ]

[ "Is there a contraction for \"I was\"? There are contractions for \"I am\" (I'm), \"I will\" (I'll), \"I have\" (I've), \"I would\" (I'd), and yet the simple past tense seems conspicuously missing. Why is that? Does that reasoning apply to \"I did\" and \"I had\" as well?", "Explain $\\iint \\mathrm dx\\,\\mathrm dy = \\iint r \\,\\mathrm \\,d\\alpha\\,\\mathrm dr$ It is changing the coordinate from one coordinate to another. There is an angle and radius on the right side. What is it? And why? I got: $2\\,\\mathrm dy\\,\\mathrm dx = r(\\cos^2\\alpha-\\sin^2\\alpha)\\,\\mathrm d\\alpha \\,\\mathrm dr$, where $x = r \\cos(\\alpha)$ and $y = r \\sin(\\alpha)$. but cannot understand and get the right side. The problem emerged when trying to integrate $\\displaystyle \\int_0^\\infty e^{\\frac{-x^2}{n^2}}\\,\\mathrm dx$ where I tried to change the problem knowing $r^2=x^2+y^2$ but stuck to this part. What is the change in the title called and why is it so?", "How to use itemize in Table environment I want to create a table like the picture below, and i wish to itemize the lamba_1 > lamba_2 > 0 using 'item style', which is the cell of each categories. Can someone help me?", "Let $P(z)=a_0+a_1z+\\cdots+a_nz^n$ be a polynomial whose coefficients satisfy $$0&lt;a_0&lt;a_1&lt;\\cdots&lt;a_n.$$ I want to show that the roots of $P$ live in unit disc. The obvious idea is to use Rouche's theorem, but that doesn't quite work here, at least with the choice $f(z)=a_nz^n, g(z)=$ (the rest). Any ideas?", "Is $\\{\\frac{m}{10^n}\\mid m,n\\in\\mathbb Z,\\ n\\geq 0\\}$ dense in $\\mathbb R$? The set $S$ of real numbers of the form $m/10^n$, $m,n$ integers and $n$ greater than or equal to $0$, is a dense subset of $\\mathbb R$ or not?? I know dense means closure of $S$ in $\\mathbb R$ is $\\mathbb R$ then it will be dense. How to prove or disprove I have no idea.", "Why does blowing on someone who is wet feel colder than on someone who is dry?", "C++ vectors (instead of arrays)", "Why is using \"for...in\" for array iteration a bad idea?", "How do I set up an account with multiple users?", "Getting polygon shapefile node coordinates and point order", "How do I run wireshark, with root-privileges? A standard installation of Wireshark doesn't give the program permission to access the network interface. I suppose I have to run the program with sudo, but do not know how to add it to the icon - if that's the way to do it.", "Probability of first actor winning a \"first to roll seven with two dice\" contest? Two players P and Q take turns, in which they each roll two fair and independent dice. P rolls the dice first. The first player who gets a sum of seven wins the game. What is the probability that player P wins the game?", "Can't join a community I look for similar questions to this one but my problem is different. I want to join this community: so I click in but I got this error: but then, I found that the community is already in list of communities: However, if I click on the community, I'm an anonymous member and even I have the option to join again but if I click on it, the problem starts again :( what can I do?", "What is the standard team composition for a conquest game? I'm very new to Smite, and I'm wondering if there is some kind of standard team composition in high level play, comparable to the top, jungle, mid, dual lane meta in LoL. What are the roles, and where should they go to start the game?", "What is the difference between 'can', 'could', 'may' and 'might'? I'm a native English speaker and I've been doing some research into English grammar for a programme I'm working on. However, on looking into modal verbs, I've only just come to appreciate how subtle and complicated they are. What is the difference between these sentences? What possible different response might one have to each? I can go to the cinema tonight. I could go to the cinema tonight. I may go to the cinema tonight. I might go to the cinema tonight. Granted, the first of these looks more like a statement of ability or possibility than the three that follow. But in what ways does it differ from the others, since all suggest ability and possibility? And crucially, what distinguishes the other three. Perhaps it's a matter of tone, of context, of the speaker... The question may appear quite simple but I haven't found a satisfactory answer elsewhere. looked quite useful in that it covered levels of confidence and certainty but it was talking about the potential state of something rather than the possibility for the person who is speaking. Are there any differences in that sense? looked at these verbs used in question form (e.g., differences between 'Can I...?' and 'May I...?') but I'm not so interested in that for now. Any thoughts appreciated.", "Does walking fast prevent eggs hatching?", "Where can I download Windows 8 legally, from Microsoft?", "I haven't found a similar question on here, though I suspect the question may be rather well-covered. I want to find a conformal map from the vertical strip $\\{z:-1&lt;Re(z)&lt;1\\}$ onto the unit disc. Under the exponential map the region is taken to the annulus with radii $e$ and $e^{-1}$, but I'm not sure how useful this will be. Can anyone advise on what the conformal map may be? Thanks.", "When is a clause not essential? I am having trouble figuring out when to use commas to set off &quot;nonessential&quot; information. Sometimes it's obvious: Bob, who is thirty years old, is an alcoholic. But other times I'm not sure: The day he quits drinking * he will start a llama farm He has his heart set on owning El Duderino ranch * in New Mexico. In the first case, my ear says that there should be a comma at *, even though information before it seems essential to me. In the second case, the stuff after * is not essential, and yet it seems a little much to use a comma. Even that last sentence I wrote confuses me. &quot;In the second case&quot; seems essential but I used a comma. Is this correct? Does it depend on personal style and the length of the clause? Or perhaps I'm misinterpreting the meaning of &quot;essential&quot; in this context?", "Symfony plugin sfDoctrineActAsTaggablePlugin not working" ]

[ "How to remove local (untracked) files from the current Git working tree", "Is it true that $||a|^p - |b|^p| \\le C_p|a - b|^p$ for $1 < p < \\infty$? If $a, b \\in \\mathbb{C}$, then we have the standard triangle inequality for the difference: $$||a| - |b|| \\le |a - b|.$$ I am wondering if this inequality generalizes to exponents greater that one. My question is, for $1 &lt; p &lt; \\infty$, does there exists a constant $C_p$ such that $||a|^p - |b|^p| \\le C_p|a - b|^p$ for all $a, b \\in \\mathbb{C}$? I am aware of the \"standard\" triangle inequality for $p &gt; 1$: $$|a +b|^p \\le 2^{p}(|a|^p + |b|^p),$$ and that $2^p$ may not be sharpest constant possible. If I try to use this estimate to prove, say, that $|a|^p - |b|^p \\le C_p |a - b|^p$, I get stuck with an extra term that I'm not sure what to do with. $$|a|^p - |b|^p \\le 2^p|a -b|^p + (2^p -1)|b|^p.$$ A resolution on this matter is greatly appreciated.", "PlotLegends disappearing with list of functions", "Is it possible to make abstract classes in Python?", "Encopresis, I'm at my wits end? Does anybody have suggestions?", "Android: How to open a specific folder via Intent and show its content in a file browser?", "See code: var file1 = \"50.xsl\"; var file2 = \"30.doc\"; getFileExtension(file1); //returns xsl getFileExtension(file2); //returns doc function getFileExtension(filename) { /*TODO*/ }", "Post Feedback link is broken I first noticed this a while back. But it has yet to resolve itself. When I click on the in the 10k tools, it hangs for a while.Then it gives me an error message:", "How to change from German to English in the File Manager in Ubuntu 15.10? My months and days in my File Manager are in German, how do I change that? On the photo you see 'Dez' : It means Dezember (German for December). I also saw one day Mittwoch (German for Wednesday). How do I change that German issue? This is only my File Manager and not completly but partially. Weird.", "How to find and replace a string by increasing its numerical part? My input file is, ami21 ami65 ami67 ami66 ami88 ami76 ami29 ami55 ami54 ami32 Using a single command line I need the output as, ami22 ami66 ami68 ami67 ami89 ami77 ami30 ami56 ami55 ami33 I used the command awk -vRS=ami '{$0=$0+1;ORS=RT}++n' inputfile &gt; outputfile but I got the outputfile as ami21ami65ami67ami66ami88ami76ami29ami55ami54ami32 i.e. all strings are written in same line and without space. Could anyone suggext me some better command line.", "Is a citizen of Canada required to apply for a US visitor visa after visiting Iran? Under new rules, non-US citizens from Visa Waiver Program countries who have visited Iraq, Syria, Iran, Sudan, Libya, Somalia, or Yemen are required to apply for a proper visa because they are no longer eligible for the VWP. Does the above apply to citizens of Canada also? Canada is not a Visa Waiver Program country, but instead Canadian citizens can enter the US visa-free. If a Canadian citizen has visited Iran for example, is the entry procedure to the US any different? I have looked through but that page does not mention Canada.", "Corrupt Backupt GPT Table", "Is it possible to configure Windows 7 to use YYYY-MM-DD instead of DD/MM/YYYY as the date format? How? Where?", "Do save bonuses stack from multiple magic items in AL? I play in Adventurers League and have a character that has a +1 Ring of Protection, which gives +1 to AC and saves. I also have a Stone of Good Luck which gives a +1 to saves and ability checks. If I equip both items and my base Dex save is +4, would it become +6 due to receiving both bonuses, or +5 with just one? I can't find much in the PHB or Google to answer this.", "Silencing \"Your disk is almost full\" notification After upgrading to macOS Sierra, I'm getting the notification that \"Your disk is almost full. Save space by optimizing storage.\": The options appear to be to store my files in iCloud, automatically delete files, or manually delete files: My problem/irritation is that I have 80GB free of my 440GB volume. The question: is there a way to silence this notification in a (semi-)permanent fashion, or to change the threshold it uses for the notification?", "Floating point calculations in LaTeX?", "Weighting features prior to SVM I'm building an object detector using HOG features and linear SVM. Some of the regions of the object are more \"distinctive\" so I would like to give more weight to the features extracted from those regions. (e.g. imagine we want to detect between mugs and glasses, then the most \"distinctive\" part is the mug's handle) How could I do this? For sure there should be a more intelligent way than just replicating the features of those \"distinctive\" regions.", "What are the pros and cons of engineered hardwood? Are there any downsides to engineered hardwood? I'm looking to install hardwood in dining room and kitchen areas.", "How do you properly use namespaces in C++? I come from a Java background, where packages are used, not namespaces. I'm used to putting classes that work together to form a complete object into packages, and then reusing them later from that package. But now I'm working in C++. How do you use namespaces in C++? Do you create a single namespace for the entire application, or do you create namespaces for the major components? If so, how do you create objects from classes in other namespaces?", "When I have a query that checks if a column of type uniqueidentifer does not exist in a table that has a null value then I get no results back. If the subquery does not return a null it works fine and it only happens when using not in. I know I can just do a not null check in my subquery, but I am curious why this does not work. Query Example: select a.guid from tableA a where a.guid not in (select b.guid from tableB AS b) Working Test: select 1 where newid() not in (select newid()) Broken Test: select 1 where newid() not in (select null)" ]

[ "What are the relationship between administrators groups of domain, dev computer and of Sharepoint services? I know-know I can search and read but anyway I would need to ask in order to escape possible typos, personal misunderstandings and to better remember. I develop on a machine with installed Sharepoint 2010 Sever where I have local groups: Administrators Description: Administrators have complete and unrestricted access to the computer/domain WSS_Admin_WPG Description: Members of this group have write access to system resources used by Microsoft SharePoint Foundation **Does the description of \"Administrators\" (\"computer/domain\") imply all privileges of \"WSS_Admin_WPG\" ? Does the description of **WSS_Admin_WPG (in part of \"system resources used by Microsoft SharePoint Foundation\") imply Sharepoint Server?** The WSS_Admin_WPG group has entries of: \"BUILTIN\\Administrators (S-1-5-32-544)\" group and some user domain accounts Is \"BUILTIN\\Administrators (S-1-5-32-544)\" group the same (alias to?) as \"BUILTIN\\Administrators\" entry I observe among Sharepoint Farm Administrators (through \"Central Administration\")? Is the entries of domain accounts excessive (or necessary) in \"WSS_Admin_WPG\" if these accounts make part of \"Administrators\" group? in \"Farm Administrators\" if these accounts are part of \"BUILTIN\\Administrators (S-1-5-32-544)\" group? What are relationship (difference) between \"BUILTIN\\Administrators\" and \"Administrators\"?", "What are best practices for managing SSH keys in a team? I work with small teams (&lt;10) of developers and admins with the following characteristics: Most members of the team have >1 personal computer, most of which are portable Team members have access to 10-50 servers, usually with sudo I think this is pretty typical for most startups and small- to mid-size corporate IT groups. What are the best practices for managing SSH keys in a team like this? Should you share a single key for the whole team? Should each person have their own key on a shared account (\"ubuntu\" on every server)? Separate accounts? Should each team member keep a separate key for each of their laptop or desktop computers?", "How many sequences of $n$ tosses of a coin that do not contain two consecutive heads have tails as the first toss? If you toss a coin $n$ times, there are $2^n$ possible sequences of heads and tails. Let $E_n$ be the set of sequences which do NOT contain two consecutive heads and $e_n$, the number of sequences in $E_n$. Thus $E_3$ $=$ $\\{$ $TTT$, $TTH$, $THT$, $HTT$, $HTH$ $\\}$ and $e_3$ $=$ $3$. How many elements of $E_n$ have $T$ as the first toss? Please can anyone help me out here?", "How to call a function on a directive scope from the controller", "Can I pickle a python dictionary into a sqlite3 text field? Any gotchas I should be aware of? Can I store it in a text field, or do I need to use a blob? (I'm not overly familiar with either pickle or sqlite, so I wanted to make sure I'm barking up the right tree with some of my high-level design ideas.)", "Android EditText listener for cursor position change", "Last year I hired someone to do some work for our website but accidentally lost the PSD files since then. It's a fairly basic concept but I am fairly inexperienced with using masks. How can I create the black circular gradient area as shown in this image below? I need to get as close as possible where it matches existing images on the site, why I am hoping its not too hard. Thank you!", "This is a story that was read on BBC radio about thirty years ago, and this is about as right as I can remember it: The human pilot of a spacecraft is doing some reconnaissance on an alien planet. He crashes but survives. For some reason, no one will know where to look for him. He sees something in the distance that looks like a building of some sort. When he gets there, it seems to be a home. Very much like a human home. There's furniture, but it's strange and uncomfortable . There's food, but it's inedible. There's a faucet but what comes out of it seems more like acid. Everything looks as though it should be right, but it's not. He leaves the house, wanders and after a few days is desperate for water. But there isn't any water anywhere. He's close to death, crawling on the ground and then something happens. There are cracks in the soil and there appears to be water bubbling up from perhaps some underground stream. The water revives him. He goes back to the house and tries the food again. It's delicious and he eats enough to gain back his strength. Then he decides to try the water again. It's pure and wonderful. He takes a shower and the last line of the story is how refreshing the water is on his skin and something about him lifting his tail.", "Are expletives (cursing, swear words or vulgar language) allowed on SE sites?", "Are antiparticles just particle-shaped holes? If particles are simply regions of space where certain quantum fields have non-zero divergence, are anti-particles simply the corresponding regions of opposite divergence? This seems like the intuitive answer, especially when considering the process of annihilation. I have heard before that anti-particles are analogous to particles moving through time in reverse, which seems to indicate that an annihilation event is just a point of symmetry in that (arguably, single) particle's history. This analogy breaks down, however, when it comes to gravitation, since there seems to be no evidence of a negative-mass particle. So what then is the meaning of an anti-particle, when their symmetry is preserved across certain fields, but not other?", "I'm stuck underground. I can't mine any further to reach lava. There is no water nearby, and zombies can't reach me. I can't see to find any blocks to suffocate my character. NBTEdit and similar programs don't work on Mac, so I can't edit my save file to escape. I have hardly any blocks so cannot jump and lay my way up. I can't see, and do not have any torches, so can't make a staircase back up. I don't want to make new save as I have an awesome house filled with stuff that took me ages to find. How can I get back to the surface?", "array package: problem with >{declarations} in preamble: Extra alignment tab has been changed to \\cr I have a document that uses both the longtable and the array package. At first I ascribed the problem to an interaction of both. After testing, it seems array is the only culprit. Here's a minimal example. \\documentclass{article} \\usepackage{array} \\begin{document} \\begin{tabular}{p{0.4\\textwidth}&gt;{\\raggedright}p{0.4\\textwidth}} 1 &amp; a \\\\ 2 &amp; b \\\\ 3 &amp; c \\\\ \\end{tabular} \\end{document} It produces the error ! Extra alignment tab has been changed to \\cr.", "This is a follow up question to my previous question Let $k$ be a field and $V \\subseteq \\Bbb{A}^n$ and $W \\subseteq \\Bbb{A}^m$ be algebraic sets. Then it should be true that $I(V \\times W ) = I(V) + I(W)$ where by $I(V)$ here we mean the extension of $I(V)k[x_1,\\ldots,x_{m+n}]$. Now I believe I have proven this (see the proof at the bottom of my question) but when I look at Martin's answer , it is instead claimed that we actually have $$I(V \\times W )= \\sqrt{I(V) + I(W)},$$ and for $I(V) + I(W)$ to be a radical ideal we need $k$ to be algebraically closed. My question is: What's going on here? I believe my claim is true even without the assumption that $k$ is algebraically closed. Here's a proof user Sanchez told me of, which I have simplified: First it is clear that we always have $I(V) + I(W) \\subseteq I(V \\times W)$. For the reverse inclusion consider a polynomial $f \\in I(V \\times W)$. Then we can always write $$f = \\sum_{i=1}^n f_ig_i$$ where $f_i \\in k[x_1,\\ldots,x_n]$ and $g_i \\in k[x_{n+1},\\ldots,x_{m+n}]$. Now take any $b' \\in W$. If for all $i$ we have $g_i(b') = 0$ then since $b'$ is arbitrary, $g_i \\in I(W)$ for all $i$. Then $f \\in I(W) \\subseteq I(V ) + I(w)$ and we are done. Otherwise suppose there exists $b \\in W$ and $i$ such that $g_i(b) \\neq 0$. Then wlog we may suppose that $g_1(b) \\neq 0$. Next, $\\sum f_ig_i(b) = 0 $ on all of $V$ by assumption of $f \\in I(V \\times W)$. So $\\sum f_i g_i(b) = p$ for some $p \\in I(V)$. Now write $$f_1 = \\frac{ p - g_2(b) f_2 + \\ldots g_n(b)f_n}{g_1(b)}.$$ Substituting this for $f_1$ in $\\sum f_ig_i$, followed by taking things mod $I(V)$ we get an expression with only $n-1$ terms $\\mod{I(V)}$. Continuing this process we will finally get an expression with $0$ terms $\\mod{I(V)}$ so that $f \\in I(V)$. This shows $I(V \\times W) \\subseteq I(V) + I(W)$ which completes the proof.", "How do I define global variables in CoffeeScript?", "Asymptote: when white isn't white I'm trying to display a white 3D ball with Asymptote (3D PDF), but it always turns up gray: import graph3; import solids; defaultrender.merge=true; size(10cm,0); currentprojection=orthographic(-Z); //currentlight=Headlamp; //currentlight=light(-10,1,1); //currentlight=White; currentlight=Viewport; draw(unitsphere,rgb(1,1,1)); I understand it's a lighting issue, and I've tried playing with its settings (the lines commented out in my source are some of my attempts), but I never manage to have white be white. If I understand correctly, I need a whiter diffuse component in my light, but I cannot see how to achieve that. And the documentation is not very clear… This will be part of a molecular model, and the rendering I'm going for it something like this:", "Booting Ubuntu Failure : error: attempt to read or write outside of disk 'hd0' I have installed Ubuntu 12.10 in a Western Digital external hard drive (320GB). This is a complete installation, not a live USB. When I plug it in my HP desktop I go to the BIOS settings and boot off the hard drive, everything work perfectly as it should. Now this works on every single computer and laptop in my house (all HP), except for ONE. My HP ProBook 4530s. When I select to boot of the USB I get the message: error: attempt to read or write outside of disk 'hd0' Now, I have removed the hard drive from my laptop and the external drive is the ONLY drive plugged in. Below is a screenshot of the message on the screen. After the message I navigate to ls / (as shown below): After here I try to acces other folders under ls /, for example, I try to go to ls /boot to get to the grub folder. Then I get the same message as before: as shown below: grub rescue&gt; ls /boot error: attempt to read or write outside of disk 'hd0' grub rescue&gt; _ The only folders I can access without getting the message again are /home, /run and /usr. So how do I: Boot Ubuntu from GRUB2 (this screen) manually Set to automatically boot Ubuntu If possible an explanation for this problem Thanks!", "Why, historically, do we multiply matrices as we do? Multiplication of matrices &mdash; taking the dot product of the $i$th row of the first matrix and the $j$th column of the second to yield the $ij$th entry of the product &mdash; is not a very intuitive operation: if you were to ask someone how to mutliply two matrices, he probably would not think of that method. Of course, it turns out to be very useful: matrix multiplication is precisely the operation that represents composition of transformations. But it's not intuitive. So my question is where it came from. Who thought of multiplying matrices in that way, and why? (Was it perhaps multiplication of a matrix and a vector first? If so, who thought of multiplying them in that way, and why?) My question is intact no matter whether matrix multiplication was done this way only after it was used as representation of composition of transformations, or whether, on the contrary, matrix multiplication came first. (Again, I'm not asking about the utility of multiplying matrices as we do: this is clear to me. I'm asking a question about history.)", "As the title says. How do I get from $\\frac{n}{\\varphi(n)}$ to $\\sum\\limits_{d \\mid n} \\frac{\\mu^2(d)}{\\varphi(d)}$? I know that $$\\frac{n}{\\varphi(n)}=\\frac{\\sum\\limits_{d \\mid n} \\varphi(d)}{\\sum\\limits_{d \\mid n} \\mu(d)\\frac{n}{d}},$$ and I suspect it is down this road I should go. But I get totally confused by the sums and I have no clue on how to divide them and \"combine\" them into one again. Any hints or advice would be much appreciated.", "What is the difference between image size and image quality?", "Run multiple instance of a program in parallel" ]

[ "A classic exponential inequality: $x^y+y^x>1$", "This appears to be a css bug which (I think) has recently been introduced. It's most visible when viewing questions on Stack Exchange sites using mobile devices (the full site with responsiveness, not the mobile site) but can easily be reproduced by resizing a browser window on a question where the combined width of the tags is large. A couple of example questions show this behaviour: On Meta Stack Overflow: On Meta Stack Exchange: Using the Meta Stack Overflow question to demonstrate (as the total width of the tags is larger): At 1100px, the tags just about fit into their containing div. At 800px, the tags appear on top of related questions: At 450px, the tags are now wider than the view (the last tag is completely off the screen), causing scroll bars to appear: This doesn't happen to lists of questions - the tags flow onto multiple lines: Reproduced on: { Firefox 81, Chrome 84, Edge 84 } on Windows 10, and Chrome 85 on Android 11.", "How do I ask LaTeX to exactly fill up a page? I understand that I can control interline spacing in LaTeX in a number of ways. The commands like , , come in handy in controlling the interline spacing. Each has its own speciality and circumstances of usage, as we can find in these discussions (, , ). If want to go for a ready made solution for controlling line spacing, packages like come in quite handy (built-in commands like \\onehalfspacing or \\setstretch for more finer controls). Anyway, my problem is a bit different. I have some text (both in paragraph and list mode) which I want to fill up exactly one page. To complicate the scenario, it may even contain equations and graphics. (Let us leave aside floats.) If I want to solve the problem statically, all I will have to is to play with some value of \\baselineskip (or \\setstretch) until satisfied. While this works good for most of the cases, I will have to go through the process again when I want to delete or add some texts. Would it be possible to have a dynamic value for \\baselineskip or \\setstretch so that my text always fills up one page? (Definitely within reasonable limits.) Another idea will be to use a number of \\vfills between some pieces of texts. But I think that this technique is usable for cover pages only. I am not putting here an MWE. I think that one is not applicable. The problem is not a theoretical one, I am preparing some kind of handout which I want to fill-up exactly one page.", "Let $\\sim$ denote the equivalence relation on the $n$-sphere $S^n$ defined via $$ (x_1,\\dots,x_n,x_{n+1})\\sim(x_1,\\dots,x_n,−x_{n+1})\\:\\text{ for all }\\: (x_1,\\dots,x_{n+1})\\in S^n. $$ Show that the quotient space $S^n/\\sim$ is homeomorphic to the $n$-disc $D^n$. I know that Ii have to show that there exists a bijective function $f: (S^n/\\sim) \\to D^n$ that is continuous and that the pre-image $f^{-1}$ is continuous as well, but I can't advance from here, any tips?", "Fastest way to move Collection from Sharded MongoDB Cluster to a another Sharded MongoDB Cluster", "Imagine that a pebble is placed on a uniformly rotating, frictionless disk. What will happen to this pebble? Will the disk slide under it and the pebble stay as is? Or will there be a centrifugal force on the pebble and it'll be thrown off the disk?", "Why is part of my model not being rendered? Why is the selected object displaying in the 3D view, but not rendering? In object mode, it shows up: However, it does not show up in render mode: Why is this so and what causes it to hide in render mode?", "I don't know so much about coordinate systems... In my office we use to deal with spatial data coming from archaeological sites. Each site has its own x-y-z coordinate system (GCS). Three simple ortogonal cartesian axis. In the last years we have been managing this spatial data through GIS software (ArcGIS), without using specific coordinate system (just leave it as \"undefined\") I'd like to know if there exisits any GCS designed to deal with such datasets using simple cartesian orthogonal axis, without grid distortions of the typical GCS. In addition, I'd like to know if this system is suitable for using it in an online mapping application. By the way, we manage 2D (ArcMap) and 3D (ArcScene) environments and work with \"mm\" as length base unit. If such a thing doesn't exists, maybe someone knows how to create it.", "I am trying to restore a database with the following command: $ sudo -u postgres pg_restore -C -d dvdrental dvdrental.tar [sudo] password for t: However, I am receiving the following error message: could not change directory to \"/home/t/mydata/.../relation model/SQL/implementations/Implementations, i.e. relational database management systems/postgreSQL/general/web/postgresqltutorial/databases\": Permission denied pg_restore: [archiver] could not open input file \"dvdrental.tar\": No such file or directory I was wondering why I can't change directory to the current directory with permission denied? File permission bits are: -rw-rw-r-- 1 t t 2838016 May 26 2013 dvdrental.tar Is it because one of its ancestry directory is not both readable and executable by any one? The file has many ancestry directories, and how can I verify that?", "The problem is stated as follows: \"Let $R$ be a Noetherian ring and $\\theta$ be a ring homomorphism from $R$ to $R$. Show that if $\\theta$ is surjective then it is also injective.\" Regardless of the right solution, I don't understand why is the following wrong: We have $\\theta: R\\to R$. By the isomorphism theorem $R/\\ker\\theta\\cong\\operatorname{Im}\\theta$. Since $\\operatorname{Im}\\theta = R$, it follows $\\ker\\theta =0$, so it's injective. Harsh criticism will be appreciated. Thanks.", "How are digital movies sent to a movie theater? For many years, movies were stored on rolls of film that were physically mailed to theaters. Now, most theaters project their movies digitally. But how are these digital movies sent to the theater? Do they mail a hard drive to the theater? Do they give the theater a username and password to a super secret website where they can download it? How does it get there?", "My problem is that I want to have different .tex files for the preamble, the presentation aroundings (my target is a beamer PDF file) and the content of the presentation. Mostly I'll be working on the content file. I even think about partitioning this content .tex file into several chapter files for a better overview. My problem with this solution is that I have to open the presentation.tex file to typeset the whole beamer PDF for looking at the results of my previous changes on the content files. (My presentation.tex file includes the preamble and the content.) Is there any way to get TeXShop to always typeset one particular file (my presentation.tex) although I'm currently working on a different one (e.g. the content.tex)? A shortcut? A command in the .tex file? An option in TeXShop? Anything?", "How to plot a function in integral form with TikZ? how to plot the function $f:x\\mapsto \\int_x^{2x}\\frac{4}{\\sqrt{1+t^4}}\\, \\textrm{d}t$ with TikZ?", "Suppose $G$ is a non-abelian group and $H,K$ are two abelian subgroups of $G$. Then must $HK$ be an abelian subgroup of $G$? I know an example, but I am confused. Thus I just want to check that.", "For some reason, be it some bad habit or something else, I can not understand why the statement \"p only if q\" would translate into p implies q. For instance, I have the statement \"Samir will attend the party only if Kanti will be there.\" The way I interpret this is, \"It is true that Samir will attend the party only if it is true that Kanti will be at the party;\" which, in my mind, becomes \"If Kanti will be at the party, then Samir will be there.\" Can someone convince me of the right way? EDIT: I have read them carefully, and probably have done so for over a year. I understand what sufficient conditions and necessary conditions are. I understand the conditional relationship in almost all of its forms, except the form \"q only if p.\" What I do not understand is, why is p the necessary condition and q the sufficient condition. I am not asking, what are the sufficient and necessary conditions, rather, I am asking why.", "Is there a sentence that begins with “them”?", "Both static_cast and reinterpret_cast seem to work fine for casting void* to another pointer type. Is there a good reason to favor one over the other?", "/dev/tcp not found When I try to run the following command: echo -e \"GET / HTTP/1.1\\n\\n\" | /dev/tcp/74.125.225.19/80 I get the following error message: bash: /dev/tcp/74.125.225.19/80: No such file or directory The following command works perfectly, so the problem involves how I'm using /dev/tcp: echo -e \"GET / HTTP/1.1\\n\\n\" | nc 74.125.225.19 80 I'm in Ubuntu 13.04, so the capability should be on my system. What am I doing wrong? What are the rules for using /dev/tcp properly?", "/boot full of kernels – what to delete? We have some Ubuntu 16.04 servers. unattended-upgrades are automatically enabled since 16.04 and /boot is a separate partition. Due to the automatic security updates, the boot partition is running out of space with new kernels. We can't reboot the systems (for availability reasons), so the machine is still using the penultimate kernel. Which kernels should I remove? All but the current, the oldest and the newest? Do you guys have some recommendations? I have also noticed that the newest kernel has the status &quot;Half Configured&quot;. This kernel would probably not work, so should I remove this one and use an older kernel? Output of dpkg -l | grep linux-image: ii linux-image-4.4.0-21-generic --&gt; old kernel ii linux-image-4.4.0-34-generic --&gt; current kernel ii linux-image-4.4.0-36-generic --&gt; new kernel ii linux-image-4.4.0-38-generic --&gt; new kernel ii linux-image-4.4.0-42-generic --&gt; new kernel ii linux-image-4.4.0-45-generic --&gt; new kernel ii linux-image-4.4.0-47-generic --&gt; new kernel ii linux-image-4.4.0-51-generic --&gt; new kernel ii linux-image-4.4.0-53-generic --&gt; new kernel iF linux-image-4.4.0-57-generic --&gt; new kernel", "In Ubuntu 17.10 ubuntu upgraded Nautilus (File Browser) to version 3.26.0. New nautilus is not using file-roller anymore, it has to an integrated compression mechanism. This makes it complicated to create encrypted archives and/or different types compression archives that file-roller does provide. How to make nautilus use file-roller as before? Related question:" ]

[ "Why are my villagers attempting to breed (they have the red hearts) but then stop breeding suddenly and gray \"angry\" particles pop up? I set up a villager breeder and set down 4 beds with 2 villagers in the middle and a carrot farmer supplying them with carrots. The first time both of those villagers bred the breeder worked perfectly fine. After that, however, the gray angry particles popped up every time they would try to breed (they would engage in breeding at a normal pace, just could not actually produce a baby). I even killed the one villager they produced in case it took a bed and even then, the two villagers would not breed anymore. Is there something I have done wrong? This seems odd considering they were only able to breed once and even by eliminating their offspring the villagers could not breed again. Edit: version is 1.16.4", "Finding minimum bounding extent of given pixel value within raster?", "Normed vector spaces over finite fields Normed vector spaces are typically defined over the reals or complex numbers. Is there any \"standard,\" well-behaved construction that generalizes this to a vector space over a finite field, such as $\\Bbb F_2$? I'm looking for something kind of like the class of $\\ell_p$ norms, except designed with finite fields in mind. Ideally, something that has deep fundamental properties making it well-behaved in the same way that the Euclidean norm is.", "ubuntu 18.04 LTS bluetooth [0cf3:3004] discovery not working", "Checking the way to stop duplicate names - validation rules or triggers", "Why do the measurements of this object seem erroneous? I just found out about the Mesh Display : Length feature in the \"N\" panel (thanks to ) that allows one to measure the length of a face or vertice. But my first encounter with this tool gives me complex feelings of love and hate, see how, as I was trying to measure the aspect ratio of this TV screen, I am getting WIDTH = 20.33 and HEIGHT = 37.57. These values seem awfully wrong, since my betrusted eyes tell me the height should be shorter than the width. I have tried measuring the single vertices as well, to identical results.", "How does Edo Tensei Madara get back his Rinnegan? Madara gave his Rinnegan to Nagato. But after Kabuto brings him back using Edo Tensei, he still has the Rinnegan. How is this possible?", "Every principal ideal domain satisfies ACCP.", "Display lines in last 10 minutes with specific pattern in logs I need to display lines with Error occurred in last 10 minutes of a log file. Aug 26 10:50:42 Normal line. Aug 26 10:51:23 Normal line. Aug 26 10:55:33 Error line. Aug 26 10:56:45 Normal line. Aug 26 10:58:12 Error line. Aug 26 11:02:31 Normal line. Aug 26 11:03:32 Normal line. Aug 26 11:04:11 Normal line. Suppose above sample of log file. I want to display only following two lines Aug 26 10:55:33 Error line. Aug 26 10:58:12 Error line. I am using AIX.", "Capistrano for Django", "How to add programs to the Unity Launcher or Ubuntu Dock? How can I add new programs to the launcher (or the dock in Ubuntu 17.10 and later) in Ubuntu?", "Are all electrons identical? Why should two sub-atomic (or elementary particle) - say electrons need to have identical static properties - identical mass, identical charge? Why can't they differ between each other by a very slight degree? Is there a theory which proves that? Imagine an alien of size of order of Milky-way galaxy examining our solar system with a probe of size of 10's of solar system dimension and concludes that all planets are identical.", "How to set root password to null", "Regulatory bodies and authoritative dictionaries for English Some languages have a \"regulatory body\" issuing recommendations and guidelines regarding the use of that language. For example in the case of Spanish it's the whose status is recognised in all Spanish-speaking countries. The Academy, among other things, publishes a dictionary (\"\"), in print and , which is usually given a lot of prestige (but is not without , of course). Are there any such authorative—or at least influential—institution(s) or publication(s) for the English language?", "In document class book, and package caption, creating index with makeidx. Index entries for the main text and for footnotes collate properly; but those for captions create their own entries. Example: for the tag \\index{New York!Custom House!\\textit{Cartouche}}, text and footnotes collate properly; but used in a caption, a new entry is created at the third level, and is also out-of-alphabetic-sequence. Note: the top level, and first sub are correct; only the second sub is duplicated. How to get the caption index entries under the same entry?", "High CPU usage by \"System\" and \"System interrupts\" (caused by ACPI.sys) I have a laptop, which was running Windows 8.1 x64 without any problems. Now with Windows 10 x64 installed, Task Manager constantly shows unusual CPU usage by \"System\" and \"System interrupts\". To solve this, I already tried the following, without success: Disabling and uninstalling all non-essential drivers. Installing newer drivers than the ones that were automagically installed (if available). Disabling/enabling fast boot option. Disabling all of the non-essential services. Sysprep. Resetting BIOS to defaults and various combinations of settings. Flashing BIOS to the latest available version. Clean install from the same media that I use for other PCs. Installing all of the updates offered in Windows Update to this day. Windows Performance Recorder / Analyzer. I'm not very familiar with Windows Performance Analyzer, so I'm hoping someone here can point me in the right direction - what exactly should I look for, to figure out which device/driver is the culprit. Or, if there's any other approach to figuring out this problem? For the brave souls, here's my and a screenshot of the problem:", "How do I convert two lists into a dictionary?", "How can I get textures on edge of walls like in Super Metroid and Aquaria? Games like Super Metroid and Aquaria present the terrain with the other facing parts having rocks and stuff while deeper behind them (i.e. underground) there's different detail or just black. I would like to do something similar using polygons. Terrain is created in my current level as a set of overlapping square boxes. I'm not sure if this rendering method will work such a system for creating terrain but if anyone has ideas I'd love to hear them. Otherwise I'd like to know how I should re-write the terrain rendering system so it actually works to draw terrain in this manner...", "How is the derivative of $\\mbox{Trace}\\left\\{ X^T A X B\\right\\}$ with respect to matrix $X$ equal to $AXB + A^TXB^T$? \\begin{align} \\nabla_X \\ \\textrm{Trace}\\left\\{ X^T A X B\\right\\} = AXB + A^TXB^T \\end{align} where $A$ and $B$ matrices are given.", "Recursive glob? I'd like to write something like this: $ ls **.py in order to get all .py filenames, recursively walking a directory hierarchy. Even if there are .py files to find, the shell (bash) gives this output: ls: cannot access **.py: No such file or directory Any way to do what I want? EDIT: I'd like to specify that I'm not interested in the specific case of ls, but the question is about the glob syntax." ]

[ "Difference between focusin/focusout and focus/blur, with example", "What follows if we fail to reject the null hypothesis? What conclusions can we draw if $p&gt;\\alpha$? Does not rejecting the $H_0$ mean anything?", "Show finite complement topology is, in fact, a topology", "Bookmark panel in Chrome/Chromium like in Firefox", "\"python\" not recognized as a command", "Can I use the Twig template engine? I do a lot of development and I like their templating language. , the , looks very much like it. How can I use Twig in Drupal 7 or even Drupal 6?", "'Guest' vs 'Guest User License' in sites?", "This is really two questions. Is there a definition of the principal $n$th root of a complex number? I can't find it anywhere. Presumably, the usual definition is $[r\\exp(i\\theta)]^{1/n} = r^{1/n}\\exp(i\\theta/n)$ for $\\theta \\in [0,2\\pi)$, but I have yet to see this anywhere. Is this because it has bad properties? For instance, according to this definition is it true that for all complex $z$ it holds that $(z^{1/a})^b = (z^b)^{1/a}$?", "How to change the light grey text that many web sites seem to use these days? Of late, I've noticed that many web sites seem to be using light grey text for many sections of their sites. Some such sections include - the text (link, usually) that shows in the status bar at the bottom of the browser when you hover the mouse over a link on their page, the indicator text in form fields to be filled in (e.g. the word \"email\" in the email address field), and many other elements on the page. That light grey makes it much less readable. Not sure whether is a new trend, or something to do with my browser settings (I haven't changed them lately, AFAIK), or Google Chrome, which is my browser. This is on Windows 7 running on a Dell Vostro laptop. I added the info about the laptop because I suspect the problem may even be due to my hardware settings, since I found the default brightness to be too high after I bought it, and changed it via Control Panel. Would like to know what are some of the things I can check or change to solve this. Thanks.", "Why do we use AC for long distance transmission? Why do we use AC (Alternating Current) for long distance transmission of electrical power? I know that AC is such a current that changes polarity (magnitude and direction) and has fixed poles.", "I'm quite new to neural networks and currently I'm trying to train a non convolutional neural network on the MNIST data set. I'm observing some behaviour I don't quite understand. This is the code written with keras as the library: # the data, split between train and test sets (x_train, y_train), (x_test, y_test) = fashion_mnist.load_data() y_train = keras.utils.to_categorical(y_train, 10) y_test = keras.utils.to_categorical(y_test, 10) model = Sequential() early_stopper = EarlyStopping(patience=3) model.add(Flatten(input_shape=(28,28))) model.add(Dense(128, activation=\"relu\")) model.add(Dense(128, activation=\"relu\")) model.add(Dense(10, activation=\"softmax\")) model.compile(loss=\"categorical_crossentropy\", optimizer=\"adam\", metrics=[\"accuracy\"]) model.fit(x_train, y_train, epochs=20, validation_data=(x_test, y_test), callbacks=[early_stopper]) This gives me a validation_acc of around 20%. The funny thing is, when I change the activation functions to \"sigmoid\", the loss function to \"mean_squared_error\" and the optimizer to \"sgd\" my performance improves to around 85% after 50 epochs. Having read I wonder what's the reason for the bad performance of the network I presented in the code. ReLU, cross-entropy and a dynamic optimizer like Adam all seem to improve on the idea of a very vanilla neural network with stochastic gradient optimization, mean squared error as loss and sigmoid activation functions. Yet I get a really bad performance and if I increase the number of nodes in the hidden layers I often get a network that doesn't learn at all. EDIT: I figured out it has something to do with me not normalizing the input to values between 0 and 1 ... but why is this the problem?", "I have the Nikon kit lens that came with a D5100 — the kit lens is . I was thinking of getting a fast lens and I am looking to buy the . Should I consider 35mm or instead buy a 55-200mm for better range?", "Should you gain rep for asking a duplicate question?", "Why did Dumbledore make it less difficult to get to the Sorcerer's Stone? The Sorcerer's/Philosopher's Stone was removed from Gringotts to be placed under the most impenetrable of protections at Hogwarts under Dumbledore's custody. But it seems clear Dumbledore took protections which could have been impenetrable, and deliberately made them less so, such that at best they would only slightly slow down anybody trying to access the Stone, rather than just plain block them. For example, after the Devil's Snare, you have a locked door enchanted such that it cannot be opened by any charm or other means except its own assigned key. That's a great protection, potentially an impassable barrier if the key is not available. But the key is then left right there in front of the door in the same room. At least the key is flying around the ceiling. But there are broomsticks right there in the same room, too. The room with the fires front and back—that could also have been a solid defense—deadly fires that cannot be passed through unless you drink very specific potions tailored to each particular fire's properties. Except that those potions providing safety are put right there in the same room. At least, perhaps, they're surrounded by other bottles, some of which contain poison. With no way to know which bottle is safe, that could still almost be a solid protection. Except that a piece of paper with a logic puzzle detailing exactly which bottles are which is put on the table with them. Dumbledore always had reasons, and those reasons were always virtuous. What was he up to, deliberately weakening the protections in this way?", "I need to delete some rows from one large table. The rows to delete shouldn't be in another table, example: DELETE FROM LargeTable WHERE id IS NOT IN (SELECT DISTINCT foreign_id from EvenLargerTable) but my server can't handle such blunt query, because there are almost a million records in the LargeTable and few million records in the EvenLargerTable How can I solve it?", "Upgrading from a modern smartphone camera without going all in on a DSLR kit", "String.Join vs. StringBuilder: which is faster?", "Find Neural Network Inputs Given Outputs I've trained a neural network with two inputs, a single hidden layer with two neurons, and one output using a bipolar sigmoid activation function. If a single input is known, how would I determine the second input to create a desired output? For example, let's say the neural network is trained to add two inputs to produce an output. So if input_1 = 3 and input_2 = 4, the output will be 7, (3 + 4 = 7). Given input_1 = 3 and the desired output is 7, I want to calculate the second input required to produce the desired output (the answer should be 4). How would I do this for a network that is more complicated than basic addition and has multiple inputs/outputs? For example, for a network with four inputs and two outputs, how would I calculate input_3 and input_4 given input_1, input_2, output_1 and output_2?", "Using QGIS 3 graphical modeler I created a model with a variety of input parameters (> 10). When starting the model, a nice user interface is generated. But the arrangement of the GUI elements is totally confused and apparently unpredictable during creating the model. It does neither seem to depend on the arrangement of input parameters in the graphical modeler nor on the chronological order in which the input parameters are added to the model. Is there a way that let's me arrange the GUI elements in the order I desire?", "How can I define a custom listing environment? I am trying to define an enviroment for a specific programming language, F#. Here's my code: \\definecolor{bluekeywords}{rgb}{0.13,0.13,1} \\definecolor{greencomments}{rgb}{0,0.5,0} \\definecolor{turqusnumbers}{rgb}{0.17,0.57,0.69} \\definecolor{redstrings}{rgb}{0.5,0,0} \\lstdefinelanguage{FSharp} {morekeywords={let, new, match, with, rec, open, module, namespace, type, of, member, and, for, in, do, begin, end, fun, function, try, mutable, if, then, else}, keywordstyle=\\color{bluekeywords}, sensitive=false, morecomment=[l][\\color{greencomments}]{///}, morecomment=[l][\\color{greencomments}]{//}, morecomment=[s][\\color{greencomments}]{{(*}{*)}}, morestring=[b]\", stringstyle=\\color{redstrings} } \\newenvironment{fslisting} { \\lstset{ language=FSharp, basicstyle=\\ttfamily, breaklines=true, columns=fullflexible} \\begin{lstlisting} } { \\end{lstlisting} } Then I'm trying to use it as such: \\begin{fslisting} type 'a Process = 'a Signal IObservable \\end{fslisting} But it doesn't work. The output log says that the listing is not terminated - or is terminated by the document. So the rest of the document is also formatted as a listing, which is of course not the intention. What am I doing wrong here?" ]

[ "Replace Tag of and xml file after pattern matching using shell I have an input xml file like below INPUT FILE &lt;ReconSummary&gt; &lt;entryName&gt;Total Deep&lt;/entryName&gt; &lt;Code&gt;777&lt;/Code&gt; &lt;License&gt;L&lt;/License&gt; &lt;Tran&gt;H20&lt;/Tran&gt; &lt;job&gt;1234&lt;/job&gt; &lt;/ReconSummary&gt; &lt;ReconSummary&gt; &lt;entryName&gt;Total Saurav&lt;/entryName&gt; &lt;Code&gt;666&lt;/Code&gt; &lt;License&gt;L&lt;/License&gt; &lt;Tran&gt;H20&lt;/Tran&gt; &lt;job&gt;1234&lt;/job&gt; &lt;/ReconSummary&gt; &lt;ReconSummary&gt; &lt;entryName&gt;Total Ankur&lt;/entryName&gt; &lt;Code&gt;555&lt;/Code&gt; &lt;License&gt;L&lt;/License&gt; &lt;Tran&gt;H20&lt;/Tran&gt; &lt;job&gt;1234&lt;/job&gt; &lt;/ReconSummary&gt; I want to comment the tag if i find the pattern &quot;Total Deep&quot; so that the output file looks like below OUTPUT &lt;!--&lt;ReconSummary&gt; &lt;entryName&gt;Total Deep&lt;/entryName&gt; &lt;Code&gt;777&lt;/Code&gt; &lt;License&gt;L&lt;/License&gt; &lt;Tran&gt;H20&lt;/Tran&gt; &lt;job&gt;1234&lt;/job&gt; &lt;/ReconSummary&gt;--&gt; &lt;ReconSummary&gt; &lt;entryName&gt;Total Saurav&lt;/entryName&gt; &lt;Code&gt;666&lt;/Code&gt; &lt;License&gt;L&lt;/License&gt; &lt;Tran&gt;H20&lt;/Tran&gt; &lt;job&gt;1234&lt;/job&gt; &lt;/ReconSummary&gt; &lt;ReconSummary&gt; &lt;entryName&gt;Total Ankur&lt;/entryName&gt; &lt;Code&gt;555&lt;/Code&gt; &lt;License&gt;L&lt;/License&gt; &lt;Tran&gt;H20&lt;/Tran&gt; &lt;job&gt;1234&lt;/job&gt; &lt;/ReconSummary&gt; Since i am new to shell scripting, can anyone help me out as to how i can apply this with the help of shell scripting?", "Is there a term for this word play where a song intentionally avoids completing a rhyme? Take this for example: In this , at 1:04 to 1:10, the person goes on rapping with a rhyming word at the end of each line, but he pauses before the end of the last word and, being humans, we predict the next word (due to the hint from the rhyme) that he is going to say but he avoids it intentionally. Is there a word or phrase for this word play? ...and the beat still knocks when I sort my socks I'm five foot eleven of sex from the tip of my head to my gorgeous... knees Not the best example I could find but I think it sums up my point quite well.", "Ckeditor toolbar not entirely showing up", "Why are effect size estimates (such as $R^2$) difficult in mixed-effects models?", "How to create posters using LaTeX I want to create posters for my poster presentation on a conference. What tools or LaTeX classes are available for preparing posters ?", "Bash File Unable to locate package when new line is added When building a bash file to execute I keep getting an error after adding a new line. I have tried moving some lines around or removing some of the packages but it will results in the same error. In the file if I was to remove 3 and 4 it there will no longer be an error. E: Unable to locate package &lt;package&gt; The bash file looks like this #!/usr/bin/env bash sudo apt update &amp;&amp; sudo apt install -y python3-pip build-essential python3-dev python3-setuptools gcc sshpass sudo apt-get install apt-transport-https lsb-release software-properties-common dirmngr sudo apt-get update The output with the error Hit:1 http://us.archive.ubuntu.com/ubuntu bionic InRelease Get:2 http://security.ubuntu.com/ubuntu bionic-security InRelease [88.7 kB] Hit:3 http://archive.ubuntu.com/ubuntu bionic InRelease Get:4 http://us.archive.ubuntu.com/ubuntu bionic-updates InRelease [88.7 kB] Get:5 http://us.archive.ubuntu.com/ubuntu bionic-backports InRelease [74.6 kB] Fetched 252 kB in 1s (189 kB/s) Reading package lists... Done Building dependency tree Reading state information... Done All packages are up to date. Reading package lists... Done Building dependency tree Reading state information... Done E: Unable to locate package sshpass Reading package lists... Done Building dependency tree Reading state information... Done E: Unable to locate package dirmngr Hit:1 http://us.archive.ubuntu.com/ubuntu bionic InRelease Get:2 http://security.ubuntu.com/ubuntu bionic-security InRelease [88.7 kB] Hit:3 http://archive.ubuntu.com/ubuntu bionic InRelease Get:4 http://us.archive.ubuntu.com/ubuntu bionic-updates InRelease [88.7 kB] Get:5 http://us.archive.ubuntu.com/ubuntu bionic-backports InRelease [74.6 kB] Fetched 252 kB in 1s (209 kB/s) Reading package lists... Done", "What does the double slash mean in `${f// /_}`? I'm learning Bash, and I want to replace space characters with other \"non blank\" characters. I'm using a for loop: for f in *\\ *; do mv \"$f\" \"${f// /_}\"; done My question is, why are the double slash and the space in ${f// /_}? What does ${f// /_} do?", "Surfing the web anonymously What is the best, fastest, safest way to surf the web anonymously, and how much anonymity can you really achieve?", "How to send variable to an inline shell-script?", "How $\\frac{1}{n}\\sum_{i=1}^n X_i^2 - \\bar X^2 = \\frac{\\sum_{i=1}^n (X_i - \\bar X)^2}{n}$ How $\\frac{1}{n}\\sum_{i=1}^n X_i^2 - \\bar X^2 = \\frac{\\sum_{i=1}^n (X_i - \\bar X)^2}{n}$ i have tried to do that by the following procedure: $\\frac{1}{n}\\sum_{i=1}^n X_i^2 - \\bar X^2$ =$\\frac{1}{n}(\\sum_{i=1}^n X_i^2 - n\\bar X^2)$ =$\\frac{1}{n}(\\sum_{i=1}^n X_i^2 - \\sum_{i=1}^n\\bar X^2)$ =$\\frac{1}{n} \\sum_{i=1}^n (X_i^2 - \\bar X^2)$ Then i have stumbled.", "I have been facing hard time understanding meaning of \"random sample\" as well as \"iid random variable\". I tried to find out the meaning from several sources, but just got more and more confused. I am posting here what I tried and got to know: Degroot's Probability &amp; Statistics says: Random Samples / i.i.d. / Sample Size : Consider a given probability distribution on the real line that can be represented by either a p.f. or a p.d.f. $f$. It is said that $n$ random variables $X_1 , . . . , X_n$ form a random sample from this distribution if these random variables are independent and the marginal p.f. or p.d.f. of each of them is $f$. Such random variables are also said to be independent and identically distributed, abbreviated i.i.d. We refer to the number n of random variables as the sample size. But one of the other statistics book I have says: In a Random Sampling, we guarantee that every individual unit in the population gets an equal chance(probability) of being selected. So, I have a feeling that i.i.d.s are elements that construct random sample, and the procedure to have random sample is random sampling. Am I right? P.S.: I am very confused about this topic, so I will appreciate elaborate reply. Thanks.", "How to show TCP listenings and filter them by local IP on Windows? Server has numerous IP addresses, set up on it's network interface. How to find, who is listening to specific IP port 80? netstat shows very long list. Are there any builtin means? UPDATE Also can't use findstr with also wishing to know process name because brocess name is displayed on separate line.", "How can I return NULL from a generic method in C#?", "Is the total energy of the universe zero?", "This is an exercise from Chapter 3 of Golan's linear algebra book. Problem: Show $\\mathbb{Z}$ is not a vector space over a field. Solution attempt: Suppose there is a such a field and proceed by contradiction. I will write multiplication $FV$, where $F$ is in the field and $V$ is an element of $\\mathbb{Z}$. First we rule out the case where the field has characteristic 2. We would have $$0=(1_F+1_F)1=1_F1+1_F1=2$$ a contradiction. Now, consider the case where the field does not have characteristic 2. Then there is an element $2^{-1}_F$ in the field, and $1=2_F(2^{-1}_F1)=2^{-1}_F1+2^{-1}_F1$ Now $2^{-1}_F1\\in\\mathbb{Z}$ as it is an element of the vector space, but there is no element $a\\in\\mathbb{Z}$ with $2a=1$, so we have a contradiction. Is this correct?", "How do I enter a file or directory with special characters in its name? I want to enter the following folder in the terminal: Milano, Torino (Jan)-Compressed How should I write the command cd to enter this directory? Spaces and several other special characters like \\, *, ), ( and ? cause problems when I try to use them in the command line or scripts, e.g.: $ cd space dir bash: cd: space: No such file or directory $ cat space file cat: space: No such file or directory cat: file: No such file or directory $ cat ( bash: syntax error near unexpected token `newline' $ echo content &gt;\\ &gt; ^C $ ls ? ( ) * ? \\ How do I enter file or directory names that contain special characters in the terminal in general?", "When installing an application, the application lists permissions that it needs to perform its functions. I am creating this list of the the system defined permissions and a description of what they mean. It is a community wiki so if new permissions are added in the future they can be added to this list.", "image of polynomial map is not an algebraic set I am doing an exercise about algebraic geometry, where the exercise tell us to provide example of the image of polynomial map $f:\\mathbb{C}^{m}\\rightarrow \\mathbb{C}^{n}$ that is not an algebraic set. But I am thinking that the image of every polynomial is $\\mathbb{C}$ thus every polynomial map is surjective. What have I misunderstand?", "Choosing C++ debugger on linux", "What determines who gets or becomes an MVP? This hasn't been asked yet, but what determines how or who gets an MVP award in CS:GO? After a match, there's always a little blurb that first states who got MVP first, and then a random fact (Player X got Y knife kills, Player X lasted Y rounds without dying, etc.). Do these two factors both \"factor\" into getting an MVP award? Is it a set percentage of enemies you kill? Is there a priority list (ie, planting bomb, defusing, etc.)?" ]

[ "How do I delete a file whose name begins with \"-\" (hyphen a.k.a. dash or minus)? How do you remove a file whose filename begins with a dash (hyphen or minus) -? I'm ssh'd into a remote OSX server and I have this file in my directory: tohru:~ $ ls -l total 8 -rw-r--r-- 1 me staff 1352 Aug 18 14:33 --help ... How in the world can I delete --help from a CLI? This issue is something that I come across in different forms on occasion, these files are easy to create, but hard to get rid of. I have tried using backslash rm \\-\\-help I have tried quotes rm \"--help\" How do I prevent the minus (dash or hyphen) character to be interpreted as an option?", "If an polynomial has a complex root, is it necessary that the conjugate of that root is also a root of the polynomial? I am not sure about this. Please comment on this.", "Significance of the second focus in elliptical orbits 1.In classical mechanics, using Newton's laws, the ellipticity of orbits is derived. It is also said that the center of mass is at one of the foci. 2.Each body will orbit the center of the mass of the system. My question is : Are the assumptions in 1 and 2 correct? Follow up question : Assuming the distance from the centre of the mass to each body remains the same, do we have two bodies orbiting the centre of the mass of the system in an elliptical or circular orbit? Finally : With elliptical orbits, if the heavier mass is supposed to be in one of the foci, if there is any significance to second focus, what is it? Is it a Lagrange point by any chance or does it have some other mathematical property?", "Are research survey questions expected to be handled with close votes?", "Can't delete files or folders on partition I have an NTFS partition. The idea is I can use this for data on either Ubuntu Mate or Windows 10 dual boot. It worked fine when I first installed Mate, but recently I no longer have the delete option when I right-click on a file or folder. The delete key does nothing. I also can't paste into the partition (Paste greyed out). It's as if the whole partition is read-only. In Gparted, the partition is marked with a key. Does this mean anything? I'm not aware of having changed anything, however, Windows recently did a big update - have they hijacked my drive? I've read related posts, but people speak of returned errors - I have no errors, just nothing happens. Also, suggested solutions seem far too technical for what must surely be a simple tick-a-box fix! Please note - for me the Terminal is where I get off a train and Sudo sounds like a Japanese noodle dish. ;) GUI's preferred if possible! Thanks for your patient help!", "Why not use exceptions as regular flow of control?", "Seems that I just proved $2=4$. Solving $x^{x^{x^{.^{.^.}}}}=2\\Rightarrow x^2=2\\Rightarrow x=\\sqrt 2$. Solving $x^{x^{x^{.^{.^.}}}}=4\\Rightarrow x^4=4\\Rightarrow x=\\sqrt 2$. Therefore, $\\sqrt 2^{\\sqrt 2^{\\sqrt 2^{.^{.^.}}}}=2$ and $\\sqrt 2^{\\sqrt 2^{\\sqrt 2^{.^{.^.}}}}=4\\Rightarrow\\bf{2=4}$. What's happening!?", "Differences in meaning when the verb tense changes (headlines) What is the difference between the examples below? Generally, in a newspaper, news is based on past tense (things which have already happened). Then why are headlines written in ways that says: He Kills (shouldn't it be: He Killed)? For example: Parliament passes bill vs. Parliament passed bill Also He kills his friend vs. He killed his friend Please help.", "Custom pagebreak in align equation", "What graduation gown should a PhD-holder wear when later receiving a Master's in another field?", "We use unit length Quaternion to represent rotations. Following is a general rotation matrix obtained ${\\begin{bmatrix}m_{00} &amp; m_{01}&amp;m_{02} \\\\ m_{10} &amp; m_{11}&amp;m_{12}\\\\ m_{20} &amp; m_{21}&amp;m_{22}\\end{bmatrix}}_{3\\times 3}\\tag 1 $. How do I accurately calculate quaternion $q = q_1i+q_2j+q_3k+q_4$for this matrix?Means how can we write $q_i$s interms of given $m_{ij}$ accurately?", "How to clear the interpreter console?", "How can tagged PDFs be created that support Universal Accessibility and reflowing? How to create tagged PDF such that they will be: good enough for PDF/UA \"reflowable\" on smaller screens and ebook readers Any syntax &amp; any engine are of interest, but I'm most interested in using LaTeX with [Xe|pdf]latex engines.", "Microbot Alpha says \"All of your minions are considered Microbots.\" Does this mean while this card is in play, every single minion in play and in discard and in my hand are considered Microbots? For every Microbot Fixer in play, does every single minion I have in play now get +1 because they are all microbots? If Microbot Archive is in play, does every single minion I have now cause me to draw a card when destroyed? If I play Microbot Reclaimer, can I shuffle any minions from my discard pile into my deck (by considering them all microbots)? It looks like this link addresses the first item above: And it looks like this link addresses the 3rd item, implying that minions in the discard are not minions because they are out of play:", "Can somebody help me with the execute commands in Minecraft? Recently, Minecraft had removed the /testfor command, which broke these sets of commands that I was trying to execute today. /testfor @p[r=10] {SelectedItem:{id:\"minecraft:feather\",tag:{display:{Name:\"Roc's Feather\",Lore:[Jump higher using this feather.]}}}}` Now normally, from Minecraft 1.13 onwards, the new /execute command would've been the replacement for the /testfor command, but as I soon found out, the command failed to detect my Roc's Feather and thus could not execute an /effect command that gave me a Jump Boost, for 1 second, at level 3. I tried remaking my feather from scratch with this command here: /give @p minecraft:feather{display:{Name:\"{\\\"text\\\":\\\"Roc's Feather\\\",\\\"color\\\":\\\"light_purple\\\",\\\"bold\\\":true,\\\"italic\\\":true,\\\"underlined\\\":false,\\\"strikethrough\\\":false,\\\"obfuscated\\\":false}\",Lore:[\"{\\\"text\\\":\\\"Jump higher using this feather.\\\",\\\"bold\\\":false,\\\"italic\\\":true,\\\"underlined\\\":false,\\\"strikethrough\\\":false,\\\"obfuscated\\\":false}\"]}} 1 But the execute command I placed did not detect this type of uniqueness. /execute if entity @p[distance=10,nbt={SelectedItem:{id:\"minecraft:feather\",Count:1b,tag:{display:{Name:\"{\\\"text\\\":\\\"Roc's Feather\\\",\\\"color\\\":\\\"light_purple\\\",\\\"bold\\\":true,\\\"italic\\\":true,\\\"underlined\\\":false,\\\"strikethrough\\\":false,\\\"obfuscated\\\":false}\",Lore:[\"{\\\"text\\\":\\\"Jump higher using this feather.\\\",\\\"bold\\\":false,\\\"italic\\\":true,\\\"underlined\\\":false,\\\"strikethrough\\\":false,\\\"obfuscated\\\":false}\"]}}}}] run effect give @s minecraft:jump_boost 1 3 true Can somebody tell me what I'm doing wrong here because I cannot even tell what's the issue.", "How do I change font size on the DataGridView?", "how to make some border lines of a table thick and colored", "Does $1.0000000000\\cdots 1$ with an infinite number of $0$ in it exist? Does $1.0000000000\\cdots 1$ (with an infinite number of $0$ in it) exist?", "Changing subject and verb positions in statements and questions", "How to differentiate a given inner product (CSIR DEC(2018) Let $A$ be a $n \\times n$ invertible matrix.Define a function $F:\\mathbb{R}^{n} \\times \\mathbb{R}^{n} \\rightarrow \\mathbb{R}$ by $F(x,y)=\\langle Ax,y\\rangle$. Let $DF(x,y)$ denotes the derivative of $F$ at $(x,y)$ which is a linear transformation from $\\mathbb{R}^{n} \\times \\mathbb{R}^{n} \\rightarrow \\mathbb{R} $. Then 1) if $x\\neq 0$,then $DF(x,0)\\neq 0$ 2) if $y\\neq 0$,then $DF(0,y)\\neq 0$ 3) if $(x,y)\\neq (0,0)$,then $DF(x,y)\\neq 0$ 4) if $x=0 \\; or \\;y=0$,then $DF(x,y)= 0$ I don't even know how to start the solution and also how to take derivative in higher dimensions. Please help! Thank you." ]

[ "I want to schedule my script for last Saturday of every month. I have come up with the below: 45 23 22-28 * * test $(date +\\%u) -eq 6 &amp;&amp; echo \"4th Saturday\" &amp;&amp; sh /folder/script.sh Is this correct or I need to change it? I can't test it right now as it will be invoked only on last saturday. Please advise. I have the below for last sunday of every month but i can't understand much of it. The first part gives 24 which is sunday and after -eq gives 7 which i don't know what it means: 00 17 * * 0 [ $(cal -s | tail -2 | awk '{print $1}') -eq $(date | awk '{print $3}') ] &amp;&amp; /folder/script.sh Can i modify the above to get last saturday? With Romeo's help I was help to come up with the below answer: 00 17 * * 6 [ $(cal -s | tail -2 | awk '{print $7}') -eq $(date | awk '{print $3}') ] &amp;&amp; /folder/script.sh", "How do I know what symbols/characters are available in a font package? I usually use xelatex, but I'm exploring pdflatex now. When loading specific fonts in xelatex, I can always know what characters the font has available, since I can inspect the font file in any font viewing program, or I can find out the hard way by just entering the unicode and see if the character is displayed in the output. But how does this work with a font package? Say, for instance, that I would like to use phonetic symbols in the font. How do I know whether the font has phonetic symbols (I assume it does), and how do I know what command I need to type in order to make them appear? My only resource is , but this only tells me what characters/commands there are available in LaTeX2e by default (depending on the font encoding), and what symbols I can find in specific packages. Phonetic symbols, for instance, are said to be in the tipa package. Does that mean I am locked to tipa if I want to use phonetic symbols with pdflatex? Here's a pointless MWE: \\documentclass{article} \\usepackage{gentium} \\begin{document} Please give me some phonetic symbols here? \\end{document}", "How can I do a line break (line continuation)?", "HowTo redirect HTTP to HTTPS on the same httpd? Here is what I have got: CentOS 5.4 (32-bit) installed Apache httpd (Server version: Apache/2.2.11 (Unix)) mod_rewrite already presents Question: how to redirect simple to not using VirtualHost defines? PS: tried to find in later answers on SF, but doesn't find nice solution. Thanks.", "How can number of subdirectories and files be determined from the output of using ls -ld command? I realize that this command only lists the directories.", "This is what happens: sudo apt-get install vlc Reading package lists... Done Building dependency tree Reading state information... Done E: Unable to locate package vlc Please help. I would also like to know when this error occurs, I've seen it before too.", "Reinstalling Windows 10 - how many digital licenses I have linked to my account I need to reinstall Win 10 (after virus). After reading online, it looks like I would be able to do it easily since my system is activated with digital license. However, I have a question. I have at least 3 PCs in my house with the same Microsoft account on them. Presumably, all of them have digital license linked to this same Microsoft account. I wonder if there is a centralized place to check all my digital licensed connected to my Microsoft account?", "Validity and Equivalence of two definitions of the real exponential function The Problem : We state the following two definitions of the real exponential function from the . We're interested in showing that the two definitions are valid $($i.e. the defining sequence/series does converge to a unique real number$)$ and that the two definitions are equivalent. I'm stuck at a couple of points $($which are described in highlighted lines$)$. Any help would be much appreciated. Thank you! Definition $1$. The exponential function can be defined as the following limit of a sequence $$\\exp x := \\lim_{n \\to \\infty} \\left({1 + \\frac x n}\\right)^n$$ Definition $2$. The exponential function can be defined as a $$\\exp x := \\sum_{n = 0}^\\infty \\frac {x^n} {n!}$$ My Progress and two places where I'm stuck : Essentially the solution consists of three parts, namely validity of definition $1$, validity of definition $2$ and equivalence of the two definitions. Validity of Definition $1$. I'm stuck here! Can we show that the sequence $(a_n)$ given by $a_n = \\left(1+\\frac{x}{n}\\right)^n$ converges for every $x \\in \\mathbb{R} ??$ Is it eventually monotone and bounded $??$ Validity of Definition $2$. The of the power series is $$r=\\lim_{n \\to \\infty}\\left| \\frac{\\frac{1}{n!}}{\\frac{1}{(n+1)!}} \\right|=\\lim_{n \\to \\infty}\\left| \\frac{(n+1)!}{n!} \\right|=\\lim_{n \\to \\infty}(n+1)=+\\infty$$ Thus the infinite series in the right-hand side of Definition $2$ converges to a unique real number for all $x \\in \\mathbb{R}$. Hence the definition is well-defined. Equivalence of Definition $1$ and Definition $2$. There's this of Definition $1$ $\\implies$ Definition $2$ in the Pr$\\infty$fWiki page, but it's kind of under construction and I'm not really convinced by it. So I decided to try to take my own shot at it. For all $n \\in \\mathbb{N} \\cup \\{0\\},$ let $$T_n=\\left(1+\\frac{x}{n} \\right)^n, ~S_n=\\sum_{k=0}^n \\frac{x^k}{k!}$$ We have to show that $\\lim_{n \\to \\infty} T_n = \\lim_{n \\to \\infty} S_n$ Now, \\begin{align} T_n &amp;= \\left(1+\\frac{x}{n}\\right)^n\\\\ &amp;= 1+n\\cdot\\frac{x}{n}+\\frac{n(n-1)}{2!}\\cdot\\frac{x^2}{n^2}+\\cdots +\\frac{n(n-1)\\cdots 1}{n!}\\cdot\\frac{x^n}{n^n}\\\\ &amp;= 1+x+\\left(1-\\frac{1}{n}\\right)\\cdot \\frac{x^2}{2!}+\\cdots +\\left(1-\\frac{1}{n}\\right)\\cdots \\left(1-\\frac{n-1}{n}\\right)\\cdot \\frac{x^n}{n!} \\end{align} Clearly, $$S_n-T_n=\\left\\{1-\\left(1-\\frac{1}{n}\\right)\\right\\}\\frac{x^2}{2!}+\\cdots +\\left\\{1-\\left(1-\\frac{1}{n}\\right)\\cdots \\left(1-\\frac{n-1}{n}\\right)\\right\\}\\cdot \\frac{x^n}{n!}\\geq 0$$ I'm stuck at this point. Can we show that $S_n-T_n \\leq B_n$ such that $B_n \\to 0$ as $n \\to \\infty ??$", "Is it possible to schedule my laptop to mute and unmute at a specific time? I always used to wake up to my favorite radio station on my alarm clock. However, I have moved and can no longer get that radio station over the air. To solve this problem, I would like to stream the station on my laptop, but have it muted overnight, then set it to unmute at a specific time in the morning, so that it will act as an alarm clock. Is there a way to schedule my laptop (Windows 7 64-bit) to unmute at a specific time?", "Real world use cases of bitwise operators", "Solving recurrence relation. Recurrence", "Caps-lock remapping stops working I have caps-lock key remapped to control, which usually works fine, but after some uptime and one/more suspend/awake cycles* this mapping breaks, and caps-lock reverts back to the default behavior -- i.e. turning on the led and capitalizing whatever I type. (Even though the Tweaks UI still shows it as being mapped to Ctrl -- see picture below.) Questions: Is this a known issue (with maybe a known fix)? (Could not find anything relevant with a quick search.) Is there a way to debug the problem, preferably from the command line? *Remark: I'm not sure it is the suspend/awake cycle that causes the problem, but I can't connect it to anything else... Remark2: removing and readding the mapping (or rebooting) solves the problem, but it would be nice to find a more permanent solution.", "Mathematica won't give eigenvectors but Wolfram Alpha will? What am I doing wrong?", "Actually I have installed the new Ubuntu 15.04 64bit, and when I'm trying to install Steam on it, there is a problem. In fact I have downloaded the deb package from steam website, installed it and when I start it nothing happens. I tried to start it from terminal and what I've got $ steam Running Steam on ubuntu 15.04 64-bit STEAM_RUNTIME is enabled automatically Installing breakpad exception handler for appid(steam)/version(0_client) libGL error: unable to load driver: r600_dri.so libGL error: driver pointer missing libGL error: failed to load driver: r600 libGL error: unable to load driver: swrast_dri.so libGL error: failed to load driver: swrast", "Better HTTPS support for Stack Exchange sites", "I noticed that the these two commands to list files below 5 GiB produce different results: find . -type f -size -5368709120c find . -type f -size -5G Specifically the one that uses kilobyte unit (5368709120c) returns additional files that are larger than the maximum file size returned by the one that uses the GiB unit (5G). From the find manual page I read the following: -size n[cwbkMG] File uses n units of space. The following suffixes can be used: `b' for 512-byte blocks (this is the default if no suffix is used) `c' for bytes `w' for two-byte words `k' for Kilobytes (units of 1024 bytes) `M' for Megabytes (units of 1048576 bytes) `G' for Gigabytes (units of 1073741824 bytes) The size does not count indirect blocks, but it does count blocks in sparse files that are not actually allocated. Bear in mind that the `%k' and `%b' format specifiers of -printf handle sparse files differently. The `b' suffix always denotes 512-byte blocks and never 1 Kilobyte blocks, which is different to the behaviour of -ls. So, given that the unit of G is 1073741824, 5G should be 5368709120c. Is the issue due to how sparse or indirect blocks are counted? Thanks in advance for the help.", "Sum of (example: 0+1+2+3 = 6 , 0+1+2+3+4+5+6+7 = 28 and so on)", "Too many blanks between summation symbol and its associated expression", "I know this is a total noob question but then again, when it comes to PostgreSQL I am a total noob... I have installed the OpenGeo suite on my computer, running Windows 7, 64-bit. I have downloaded the tutorial data and have been working through it. I would like to access the database that I have made with ArcGIS so I can start learning about how that works. However, when I try to connect to the database using the \"Add Database Connection...\" I can't seem to figure out what to put in for 'Instance' - everything I've tried (localhost, localhost,54321, my IP address with and without the port, my computer name) doesn't seem to work. I installed and created the nyc test database according to all the instructions in the OpenGeo tutorial pages but am at a total loss here. I know this must be an easy thing to deal with, I just can't get my head around it. Can someone with more experience throw me a bone on this one? Frustratingly enough, QGIS connects to the database with almost no effort and everything works fine - but my organization is heavily ESRI focused and switching to QGIS is a long shot... EDIT Thanks everyone for pitching in on this. I really appreciate the advice, it's what makes this site great. I have installed OpenGeo Suite 3.0.1 with no extensions ArcGIS Desktop 10.1, no license for server I just went to the Opengeo website and downloaded the Windows installer and installed the default configuration. I have tried every permutation for the instance name that I can think of - using colons and commas, my machine name, localhost, postgresql, server, my IP address, random curse words, anything I can think of. I have been using port 54321 instead of 5432 because that is what the OpenGeo workshop told me to set up my 'nyc' practice database to use. It seems that localhost should work, here is a shot of the server properties from pgAdmin:", "Python rounding error with float numbers" ]

[ "A coin is tossed three times. The probability of zero heads is 1/8 and the probability of zero tails is 1/8. What is the probability that there is at least one head and at least one tail? So, if P(zero heads)= 1/8 , then that should be the same of p(all tails)? We would use the complement rule and Multiplication Rule? P(at least one head) = 1 - P(no heads) = 1 - 1/8= 7/8 P(at least one tail) = 1 - P(no tails) = 1 - 1/8= 7/8 would I multiply the two values?", "Can the weak force create a bound state?", "Custom cross-reference formats (e.g. \"Equation 1\" instead of just \"1\")", "How long does the new dwellers queue last? When clicking the radio room icon that attracts a new dweller to your vault, how long will they stay queued out in front of the vault for before giving up? Or will they? I'm at max population and would rather not kill existing dwellers to accommodate them in my vault.", "How to handle calendar TimeZones using Java? I have a Timestamp value that comes from my application. The user can be in any given local TimeZone. Since this date is used for a WebService that assumes the time given is always in GMT, I have a need to convert the user's parameter from say (EST) to (GMT). Here's the kicker: The user is oblivious to his TZ. He enters the creation date that he wants to send to the WS, so what I need is: User enters: 5/1/2008 6:12 PM (EST) The parameter to the WS needs to be: 5/1/2008 6:12 PM (GMT) I know TimeStamps are always supposed to be in GMT by default, but when sending the parameter, even though I created my Calendar from the TS (which is supposed to be in GMT), the hours are always off unless the user is in GMT. What am I missing? Timestamp issuedDate = (Timestamp) getACPValue(inputs_, \"issuedDate\"); Calendar issueDate = convertTimestampToJavaCalendar(issuedDate); ... private static java.util.Calendar convertTimestampToJavaCalendar(Timestamp ts_) { java.util.Calendar cal = java.util.Calendar.getInstance( GMT_TIMEZONE, EN_US_LOCALE); cal.setTimeInMillis(ts_.getTime()); return cal; } With the previous Code, this is what I get as a result (Short Format for easy reading): [May 1, 2008 11:12 PM]", "USB stick mysteriously become write protected So, somehow over the weekend, my 1GB USB flash drive has managed to become write-protected. There is no switch on the stick, so I'm concluding that something has corrupted at some point. Obviously I can't format it or remove. The output from dmesg | tail is: Buffer I/O error on device sdb1, logical block 328168 lost page write due to I/O error on sdb1 sd 73:0:0:0: [sdb] Unhandled sense code sd 73:0:0:0: [sdb] Result: hostbyte=DID_OK driverbyte=DRIVER_SENSE sd 73:0:0:0: [sdb] Sense Key : Data Protect [current] Info fld=0x0 sd 73:0:0:0: [sdb] Add. Sense: Write protected sd 73:0:0:0: [sdb] CDB: Write(10): 2a 00 00 05 08 00 00 00 01 00 Buffer I/O error on device sdb1, logical block 328200 lost page write due to I/O error on sdb1 I think the second and final lines are a giveaway to corruption, but I don't know how to interpret this output. Could someone help to see if this output gives any indication? I usually eject the drive before removing it, but I may have been lax once or twice. The data isn't critical, it's just bugging me. Any suggestions on how to fix it (if the drive even can be) would be greatly appreciated.", "WIth Vimeo Plus account, how to hide/remove the \"play\" button in the middle of an embedded video?", "What is a StackOverflowError, what causes it, and how should I deal with them?", "Is it possible to cross the Wagan border by car? I was planning a trip by car when I found something a bit weird in :if you try to cross from Lahore to India, it tells that you have to 6457 km detour. Is it possible to cross this border driving? If not, is there another way to cross without having to make more than 6000 km?", "Getting image dimensions without reading the entire file", "How to fix \"W: Duplicate sources.list entry\"? I keep getting this warning whenever I try to run sudo apt-get update. W: Duplicate sources.list entry http://archive.ubuntu.com/ubuntu/ precise-updates/main i386 Packages (/var/lib/apt/lists/archive.ubuntu.com_ubuntu_dists_precise-updates_main_binary-i386_Packages) W: You may want to run apt-get update to correct these problems Below is the output from /etc/apt/sources.list file: deb http://archive.ubuntu.com/ubuntu precise main restricted deb-src http://archive.ubuntu.com/ubuntu precise main restricted deb http://archive.ubuntu.com/ubuntu precise-updates main restricted deb-src http://archive.ubuntu.com/ubuntu precise-updates main restricted deb http://archive.ubuntu.com/ubuntu precise universe deb-src http://archive.ubuntu.com/ubuntu precise universe deb http://archive.ubuntu.com/ubuntu precise-updates universe deb-src http://archive.ubuntu.com/ubuntu precise-updates universe deb http://archive.ubuntu.com/ubuntu precise multiverse deb-src http://archive.ubuntu.com/ubuntu precise multiverse deb http://archive.ubuntu.com/ubuntu precise-updates multiverse deb-src http://archive.ubuntu.com/ubuntu precise-updates multiverse deb http://archive.ubuntu.com/ubuntu precise-security main restricted deb-src http://archive.ubuntu.com/ubuntu precise-security main restricted deb http://archive.ubuntu.com/ubuntu precise-security universe deb-src http://archive.ubuntu.com/ubuntu precise-security universe deb http://archive.ubuntu.com/ubuntu precise-security multiverse deb-src http://archive.ubuntu.com/ubuntu precise-security multiverse How do I fix it?", "How can I copy a custom Dictionary on Word 2000?", "NVMe PCIe x4 SSD on M.2 PCIe x2 slot? i'm about to get a new SSD for my PC, and before spending the money i have some doubts about my decision i would like to clarify First, my mobo is a B450 Aorus Pro Wifi, it has 2 M.2 slots, one of them full length (22110) compatible with PCIe 3.0 x4 and the other one standard length (2280) and support only for PCIe 3.0 x2 About the drive, i'm aiming for a 1tb XPG SX8200 Pro , which is a PCIe 3.0x4 SSD My first M.2 slot is already taken by the main SSD, which i use for the OS and other stuff, i can't really use it. Will a PCIe x4 SSD work on a PCIe x2 slot? How much performance will be lost if it does? Will it be worth it?", "Maximum power transfer proof I have the following homework problem. Consider a power supply with fixed emf $ε$ and internal resistance $r$ causing current in a load resistance $R$. In this problem, $R$ is fixed and $r$ is a variable. The efficiency is defined as the energy delivered to the load divided by the energy delivered by the emf. When the internal resistance is adjusted for maximum power transfer, what is the efficiency? The answer is 50% but I'm confused how this is calculated. Here is my thought process so far. The power dissipated in the load is $I^2R$ and $\\displaystyle I = \\frac{ε}{r+R}$ so $\\displaystyle P = \\frac{ε^2R}{(r+R)^2} = \\frac{ε^2}{\\frac{r^2}{R} + 2r + R}$ and so power transferred to the load will be maximum when $\\displaystyle \\frac{r^2}{R} + 2r + R$ is a minimum. Taking the first derivative $\\displaystyle \\frac {d}{dr}(\\frac {r^2}{R} + 2r + R) = (\\frac{2r}{R} + 2)$ and this equals 0 when r = -R. The second derivative is $\\displaystyle \\frac{2}{R} &gt; 0$ so this point would be a minimum and therefore max power transferred when r = -R. But having $r = -R$ doesn't make sense to me. From what I read, for maximum power transfer $r$ should equal $+R$. So I've probably done something wrong in my calculations or assumptions in the previous paragraph. Also wouldn't max power be transferred when the internal resistance is as close to zero as possible? Can someone please show me a proof that shows why $r = R$ for max power transfer and then how to calculate the efficiency.", "Removing nodes from an XmlDocument The following code should find the appropriate project tag and remove it from the XmlDocument, however when I test it, it says: The node to be removed is not a child of this node. Does anyone know the proper way to do this? public void DeleteProject (string projectName) { string ccConfigPath = ConfigurationManager.AppSettings[\"ConfigPath\"]; XmlDocument configDoc = new XmlDocument(); configDoc.Load(ccConfigPath); XmlNodeList projectNodes = configDoc.GetElementsByTagName(\"project\"); for (int i = 0; i &lt; projectNodes.Count; i++) { if (projectNodes[i].Attributes[\"name\"] != null) { if (projectName == projectNodes[i].Attributes[\"name\"].InnerText) { configDoc.RemoveChild(projectNodes[i]); configDoc.Save(ccConfigPath); } } } } UPDATE Fixed. I did two things: XmlNode project = configDoc.SelectSingleNode(\"//project[@name='\" + projectName + \"']\"); Replaced the For loop with an XPath query, which wasn't for fixing it, just because it was a better approach. The actual fix was: project.ParentNode.RemoveChild(project); Thanks Pat and Chuck for this suggestion.", "Is it true that $aH = bH$ iff $ab^{-1} \\in H$ Let $H$ be a subgroup of a group $G$. The I know that for $a,b\\in G$ we have $aH = bH$ if and only if $a^{-1}b \\in H$. My question is if it is also true that $aH = bH$ if and only if $ab^{-1} \\in H$? Does it matter where the $-1$ goes? I am guessing that this is not true since we keep putting the $-1$ on the left element, but I am also thinking that it might be true because they look like the same. If $G$ is abelian, then it doesn't matter, so a possible counter example would have to involve a non-abelian group. If $H$ is a normal subgroup, then it should also be true because then $a^{-1}bH = Ha^{-1}b$.", "Proving the limit of a function of a sequence is equal to the function of the limit of that sequence Suppose $f$ is a continuous function at $x = c$ in $[a,b]$. Prove that for any sequence ${x_n}$ in $[a,b]$ converting to $c$, the sequence $\\{f(x_n)\\}$ converges to $f(c)$. That is, $$ \\lim_{n\\to\\infty}f(x_n)= f\\left(\\lim_{n\\to\\infty}x_n\\right)$$ This proof seems simple but there are a few things that I need to know first. If $\\{x_n\\}$ converges to $c$, is it sufficient to substitute $c$ in for $\\lim_{n\\to\\infty}x_n$? Also needing some guidance on the structure of this proof. Thanks!", "Prove: If a sequence converges, then every subsequence converges to the same limit. I need some help understanding this proof: Prove: If a sequence converges, then every subsequence converges to the same limit. Proof: Let $s_{n_k}$ denote a subsequence of $s_n$. Note that $n_k \\geq k$ for all $k$. This easy to prove by induction: in fact, $n_1 \\geq 1$ and $n_k \\geq k$ implies $n_{k+1} &gt; n_k \\geq k$ and hence $n_{k+1} \\geq k+1$. Let $\\lim s_n = s$ and let $\\epsilon &gt; 0$. There exists $N$ so that $n&gt;N$ implies $|s_n - s| &lt; \\epsilon$. Now $k &gt; N \\implies n_k &gt; N \\implies |s_{n_k} - s| &lt; \\epsilon$. Therefore: $\\lim_{k \\to \\infty} s_{n_k} = s$. What is the intuition that each subsequence will converge to the same limit I do not understand the induction that claims $n_k \\geq k$", "Intuition behind the definition of a measurable set", "Is the EmDrive, or \"Relativity Drive\" possible? In 2006, New Scientist magazine published an article titled 1 [] about the [] which stirred up a fair degree of controversy and that New Scientist was engaging in pseudo-science. Since the original article the inventor claims that a \"Technology Transfer contract with a major US aerospace company was successfully completed\", and that papers have been published by Professor Yang Juan of The North Western Polytechnical University, Xi'an, China. 2 Furthermore, it was that the Chinese were going to attempt to build the device. Assuming that the inventor is operating in good faith and that the device actually works, is there another explanation of the claimed resulting propulsion? Notes: 1. Direct links to the article may not work as it seems to have been archived. 2. The abstracts provided on the website claim that they are Chinese language journals which makes them very difficult to chase down and verify." ]

[ "I am looking to sell and buy a house. But with the current market being as crazy as it is (houses are selling fast for sometimes 150,000 over asking), I'm afraid if we sell first, we could be stuck without a new house. Or stuck settling on or over-paying for something and wishing we never sold at all. I'm wondering if it's possible to buy first. What is the best way to secure my next house before selling my current house without getting locked into a B-lender mortgage or risking too much? I know there would be some risk putting an offer on a new house without knowing how much the current house will sell for, or the risk we don't sell the current house before the new house closes. I'm also afraid conditional offers will not be considered. Are there any other options? (We do have a mortgage on the current house, but because the market has gone up so much there is also a good chunk of equity.)", "Install Linux from Linux", "Please add TeX rendering on the Android app", "If $G$ is abelian, then the set of all $g \\in G$ such that $g = g^{-1}$ is a subgroup of $G$ Prove that if $G$ is abelian then the set $H$ of all elements of $G$ that are their own inverses is a subgroup of $G$. Naturally in an abelian group, $ab = ba$ for $a, b \\in G$, however I'm not sure how to show the set elements that are their own inverses is a subgroup of $G$ using arbitrary elements.", "How can I request a random row (or as close to truly random as is possible) in pure SQL?", "Is it possible to have 2 git repositories in one directory? I'd think not, but thought I'd ask. Basically, I'd like to check in my home directory config files (e.g. .emacs) which should be common across all of the machines I work on, but have a second repository for local files (e.g. .emacs.local), which contains machine-specific configurations. The only way I can think of to do that is to have the local config in a subdirectory and ignore that subdirectory from the main git repository. Any other ideas?", "It's often the case that I want to change name servers because my site is messed up. Well, it takes a very long time for the name server to propagate. Is there something in DNS, or registrar or anything I can do to speed that up. Flushing my dns server using and it rarely works", "Can a PC be a lich? The heading says it all, can a PC be a lich? If so, how? The DMG hints that the Book of Vile Darkness contains the secrets of how; there is nothing official otherwise.", "I know that I can use to make cross-references and hyperlinks clickable. That makes the clickable areas outlined in fluorescent green, however. How can I make the green boxes go away?", "Is there a \".bashrc\" equivalent file read by all shells? Is ~/.bashrc the only place to specify user specific environment variables, aliases, modifications to PATH variable, etc? I ask because it seems that ~/.bashrc seems to be bash-only, but other shells exist too…", "Is there a documentclass that produces 'endless' pages? Does anybody know of a documentclass that produces a page that has a fixed width and a variable length, depending on the actual content that needs to fit on the sheet? I'm trying to get something like a kind of scroll if possible.", "Calculator Program improvements I'm pretty new to programming and made a few programs so far. I recently made a Calculator program and I hope you guys could tell me what I could do to improve. int firstNumber; string sign; int secondNumber; int answer; Console.WriteLine(&quot;Input Number:&quot;); firstNumber = Convert.ToInt32(Console.ReadLine()); Console.Clear(); Console.WriteLine(&quot;Input Sign:&quot;); sign = Console.ReadLine(); Console.Clear(); Console.WriteLine(&quot;Input Second Number:&quot;); secondNumber = Convert.ToInt32(Console.ReadLine()); Console.Clear(); switch (sign) { case &quot;+&quot;: answer = firstNumber + secondNumber; Console.WriteLine(answer); Console.ReadKey(); break; case &quot;-&quot;: answer = firstNumber - secondNumber; Console.WriteLine(answer); Console.ReadKey(); break; case &quot;*&quot;: answer = firstNumber * secondNumber; Console.WriteLine(answer); Console.ReadKey(); break; case &quot;/&quot;: answer = firstNumber / secondNumber; Console.WriteLine(answer); Console.ReadKey(); break; default: Console.WriteLine(&quot;Invalid Input&quot;); break; }", "How to book this complex multi carrier roundtrip flight I found on ITA? I am trying to book a roundtrip ticket from Chicago O'hare (ORD) to Mumbai, India (BOM). Traveling on Aug 9th and returning on Aug 24th. Now, I've been looking for several days (almost 10days!) for ways to book this itinerary I found on ITA. All other websites like Expedia, Kayak, Travelocity, Momondo, RouteHappy, and even google flights are quoting around $1200 roundtrip cost, sometimes as low as $1150. But the ITA Matrix website shows me several options, the lowest is $916 roundtrip. You can see there are several flights in the $900 range. For the return trip there is only one option to get the low price. Selecting the flights this is what I get: I'm not sure how to use the fare codes the ITA website provides to purchase this itinerary. These are some of the things I have tried to book the complex multi-carrier flight from ITA: My first method was to try coding into HIPMUNK, using the multi-city option, my departure, connections, airlines flights number and dates. Following this method: And the results page: Here's what my code into HIPMUNK looks like: ORD::LH9151 FRA LH756 for the first journey and BOM::LX155 ZRH SN5104 BRU SN8803 for the return trip. Don't think I'm making any mistakes in coding it, but there are two adjustments I also made which failed: I used the dates of the first leg of the flight then tried using the other dates as well. So for example Aug 9th and Aug 10th. I used the codes for the operating carriers and when it didn't work, the marketing carrier leaving the flight number unchanged. This always returned no results. Breaking up the itinerary to just the oneway from ORD to BOM worked but gave me a price of $624. For some reason the second return trip was creating problems. I tried breaking he return trip down into different segments but no luck. Anyone knows why the return trip is creating difficulties? Coding issues/ hipmunk doesn't have such a large database? Then I tried method 2: Calling up the airlines United was able to find all the segments, even price it correctly sometimes (sometimes not) and gave me a confirmation number. I was to call them in 12hrs to check if they were able to procure the seats but when I did call they were not able to get the seats for the SWISS flight from BOM to ZRH and/or from ZRH to BRU. I've tried this at least 5 times changing small things everytime, but the same result. It seems Lufthansa waits for SWISS to confirm the seats but SWISS doesn't respond in time and I'm not able to book. I tried calling Lufthansa but they were not even able to find the segments and instead told me to look at booking online where I will be able to find it cheaper. Any insights into the methods that failed or suggestions on how to book this itinerary at the $900 price will be much appreciated. Thanks in advance.", "Booting a Windows 7 installation on different hardware I'm in a situation where I could do with very quickly migrating a Windows 7 (RTM x64) installation from one machine to another. What options are open to me in terms of getting W7 to boot after the drive is picked up and moved from one box to another? I thought it was supposed to be a little less sensitive to this kind of move than XP, but it doesn't work - it is stuck in a reboot loop and never reaches a GUI. Tried a few things so far, none of which have worked: Changed SATA mode in the BIOS of the target machine between ATA and AHCI run Windows 7 Startup Repair tried safe mode, no change (I will keep this list up to date as suggestions come in) UPDATE: I can confirm this reboot loop is due to STOP error 0x0000007B, and these codes follow: 0xFFFFF880009A98E8 0xFFFFFFFFC0000034 0x0000000000000000 0x0000000000000000 UPDATE: I didn't get anywhere on this and I ended up just rebuilding the machine. I think it should be theoretically possible, so I'm going to leave the question open in case someone comes along in future with an answer.", "Every finitely generated algebra over a field is a Jacobson ring Knowing that the polynomial ring in $n$ variables over a field $k$ is a Jacobson ring, how can we prove from it that every finitely generated $k$-algebra is a Jacobson ring? EDIT: We define a ring to be Jacobson if every prime ideal is an intersection of maximal ideals.", "Is this a valid partial fraction decomposition? Write $\\dfrac{4x+1}{x^2 - x - 2}$ using partial fractions. $$ \\frac{4x+1}{x^2 - x - 2} = \\frac{4x+1}{(x+1)(x+2)} = \\frac{A}{x+1} + \\frac{B}{x-2} = \\frac{A(x-2)+B(x+1)}{(x+1)(x-2)}$$ $$4x+1 = A(x-2)+B(x+1)$$ $$x=2 \\Rightarrow 4 \\cdot2 + 1 = A(0) + B(3) \\Rightarrow B = 3$$ $$x = -1 \\Rightarrow 4(-1) +1 = A(-3)+ B(0) \\Rightarrow A = 1$$ Thus, $$\\frac{4x+1}{x^2-x-2} = \\frac{1}{x+1} + \\frac{3}{x-2}\\textrm{.}$$ The substitution of $x$ ($x = 2, -1$) is a common method to find out the coefficient of the partial fractions. However, the equation on the third line is obtained by multiplying $(x+1)(x-2)$, which is assumed to be nonzero. Here we have a contradiction. Furthermore, the original function is not defined at $x=-1,2$. How can we substitute these value for $x$? So is this method valid and rigorous? How to modify it so that it is rigorous?", "I need to find the intersection point of 2 line segments (lines are finite, i.e., they have end points). e.g. segment 1 from $(x_1, y_1)$ to $(x_2, y_2)$ -- segment 2 from $(x_3, y_3)$ to $(x_4, y_4)$ you can assume $m_1$ and $m_2$ are the gradients of segment 1 and segment 2 respectively similarly, $c_1$ and $c_2$ being the y-intercepts of segment 1 and segment 2 respectively Using $y=mx+c$ I can easily find the equations of both lines and then derive the intersection point from those equations and check if that point actually lies on both the line segments (intersection point may not lie between the end points). My problem is when I calculate the gradients $m_1$ and $m_2$ I do $\\frac{y_2-y_1}{x_2-x_1}$ there for if one of the lines is vertical then I am going to have problems. How can I deal with this? Another problem is that if the two segments intersect at a point which is also the same as one of the end points then I want to assume that they are not intersecting. e.g. if segment 1 is from $(2, 3)$ to $(3, 7)$ and segment 2 is from $(3, 7)$ to $(7, 3)$ then I want to assume they don't intersect.", "Prove a differentiable function between banach spaces is continuous I really don't know where to start with this problem. It intuitively makes sense from basic calculus knowledge but I have absolutely no clue how to show it. ,", "WordPress site displaying 404 for any page apart from index My WordPress site is returning a 404 not found error on any page apart from the homepage and /wp-admin. I have no absolutely no idea why this is. My Permalinks are set up to use /year/month/date/post-title/ (e.g www.domain.com/2014/04/28/sample-post/). When I change the permalinks to the default (?p=123) it works fine, but not on any of the other ones. Here is the contents of the .htaccess file: &lt;IfModule mod_rewrite.c&gt; RewriteEngine On RewriteBase / RewriteRule ^index\\.php$ - [L] RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule . /index.php [L] &lt;/IfModule&gt; I have also installed the plugin 'Debug This', which provides details on the Rewrite Rules. However because it's a pretty big list and unformatted it would look quite bad, I've put it in a jsfiddle, here: I think that's all the details I have, I've disabled all plugins and stuff like that. Thanks for any help. EDIT: ok so I've since discovered a bit more info. I also forgot to say that the host for the site is Heroku (I'm building for a client and for some reason he's insisting I use Heroku, which is bad choice for WP I know but I can't persuade him otherwise so that's life). I recently installed , which also installed Nginx. So I'm assuming that's whats broken my Permalinks. I then found , which seems to be about the issue I'm having, which links to this page on the Nginx Documentation. Problem is I've never used Nginx before so I don't know where to put all the code it's got in the first section entitled Abridged Basic Setup. Can someone help me out? Thank you :)", "how to play wav file in python?" ]

[ "$f(x,y)=4x^3y^2$ Dealing with Directional Derivatives and Vectors Let $f(x,y)=4x^3y^2$ How do I find the directional derivative of $f$ at $(2,1)$ in the direction of the vector $3i-4j$? What would be a unit vector in the direction in which $f$ decreases most rapidly from the point $(2,1)$? And, what is the rate of change of $f$ in the direction given in the second question? My Work (What I have done so far): For the first question: $\\nabla f(x,y)=12x^2y^2$i$+8x^3y$j$\\nabla f(2,1)=48$i$+64$j$u=(3/5)$i$-(4/5)$j $\\therefore D_u f=\\nabla f\\bullet u=0$ I'm not entirely sure if this is right? Can someone please verify? For the second question: $u=(3/5)$i$-(4/5)$j $\\therefore -||\\nabla f(2,1)||=$? How do I find this? And am I doing this right? I have no idea what to do for the third question.", "How was the binomial coefficient of the binomial theorem derived? $$\\frac{n!}{k!(n-k)!}$$", "I have a file with the lines like below. title1:A1 title2:A2 title3:A3 title4:A4 title5:A5 title1:B1 title2:B2 title3:B3 title4:B4 title5:B5 title1:C1 title2:C2 title3:C3 title4:C4 title5:C5 title1:D1 title2:D2 title3:D3 title4:D4 title5:D5 How can I achieve this? title1 title2 title3 title4 A1 A2 A3 A4 B1 B2 B3 B4 C1 C2 C3 C4 D1 D2 D3 D4", "I've just upgraded from Ubuntu 18.04 to its newest LTS version - 20.04. While it comes with some interesting changes, the Desktop icon system was messed up in my opinion. When you hover the mouse cursor over the icons, you see a huge space marked around them that cannot be violated (as you can see in the image below) so that they need to be placed very far apart from each other. 18.04 allowed you to place icons much closer to each other and didn't have that marked space around them. This new way leaves much less space on the Desktop to organize large amounts of icons - including folders, files and shortcuts. Is there a way I can significantly reduce the size of icons and their \"spaces\" or go back to the old system of organizing files? On \"Settings\", there is a tool to change the size of Dock icons, but not of Desktop icons. Also, every time I move or delete something, the Desktop \"flashes\" and the icons seem to rearrange themselves automatically, nothing of which happened in 18.04. I also can't move anything directly to the Desktop; I need to move to the Desktop folder on Nautilus. This makes me start to think about downgrading Ubuntu back to 18.04.", "What algorithm for a tic-tac-toe game can I use to determine the \"best move\" for the AI?", "Prove that if every node in a simple graph $G$ has degree $3$ or higher, then $G$ contains a cycle with a chord.", "How to do version numbers? My company is building a product. It's going to be versioned by SVN. It's a webapp so basically there will never be a version out which doesn't have some features in them and thus could always be labeled as beta. But since it's going to be a corporate product I really don't want the \"unstable watchout\" on there. So how would you go about versioning? Is 1.0 stable? Should the build date be in the version number? Tell me what you guys think!", "Difference between Login Shell and Non-Login Shell? I understand the basic difference between an interactive shell and a non-interactive shell. But what exactly differentiates a login shell from a non-login shell? Can you give examples for uses of a non-login interactive shell?", "Correct formula for LED current-limiting resistor? I'm trying to work out what value resistor to use in a LED circuit. The equation I'd use to do this is: $$ R = \\frac{V_{cc} - V_f}{I_f} $$ Seems logical, and makes complete sense. The answers to the question confirm this too. I have the following LEDs: \\$ V_f = 3.3V \\$ \\$ I_{f_{typ}} = 20mA \\$ Using a 5V power supply: \\$ V_{cc} = 5V \\$ Plugging these into the above equation gives: $$ \\begin{eqnarray} R &amp; = &amp; \\frac{V_{cc} - V_f}{I_f} \\\\ &amp; = &amp; \\frac{5V - 3.3V}{20mA} \\\\ &amp; = &amp; 85\\Omega \\end{eqnarray} $$ All good so far. However, if I use the calculator at , that gives me 100&Omega;. If I use the ElectroDroid app on my phone, that gives me 85&Omega;. So, I assume that the linear1 calculator is using a different method of calculating this resistor value; is there some better way of doing this?", "What do 'real', 'user' and 'sys' mean in the output of time(1)?", "How do I open Chromium in incognito mode by default? I would like to be able to open Chromium in incognito mode automatically. I'm new to Linux and I love it so far but I haven't yet found a way to do this. I'm using Ubuntu 14.04.", "I flew a long range flight carrying my laptop, a quite heavy one, inside a neoprene briefcase in the passenger cabin. The recommendation by the aircrew was to place it in the overhead compartment or under the seat in front of me. However, during take-off and landing, the vibrations on the plane are quite strong and, as a result, it received minor damage. Placing them in the overhead compartment might be equivalent to placing it on the floor under the seat, with the added issue of additional luggage in the compartment shifting. I considered the alternative of holding the laptop by the handle while sitting, so it won't be any contact with the aircraft's floor. This is impracticable during cruise, but I thought it could be better during the take-off and landing segments. Another option I considered is to wrap it with completely with bubble wrap before boarding the plane. Which is the safest way to transport a laptop during flight?", "Am I able to change my GPA once I submit a graduate school application?", "Remove duplicates from a List in C# Anyone have a quick method for de-duplicating a generic List in C#?", "Why is the time limit for editing comments 5 minutes?", "Bring all planes in mesh to same level I have added a plane in top view. I have then extruded the plane according to a floorplan in topview. I don't know what happened, but when I switched my view, I could see that some parts of it are for some reason high up in the air. I would like to ask how I can bring everything back down onto the grid / floor. And if somebody could tell me how this might have happened, I would also be glad.", "Permanently removing apache2", "Why not use a WAMP stack? This is a about the use of a *AMPP's stack. I recently had a talk with some experienced people and they suggested to me not to use a WAMP stack, and instead install apache, mysql and php separately. I don't understand why they have suggested this, though, so can anyone tell me? Is there a particular disadvantage of WAMP, or a particular advantage to installing all of them separately? Since a WAMP stack itself is composed of apache, mysql and php, then what's the difference between using the WAMP stack and installing them all separately?", "Basically, I want to have a single operator which can do multiple things, based on some attributes values. class MyPanel(bpy.types.Panel): # (...) layout = self.layout row = layout.row() row.operator(\"my.button\", text=\"Button text\") class MY_BUTTON_OT_Button(bpy.types.Operator): bl_idname = \"my.button\" bl_description = \"Button description\" bl_label = \"Button\" foo = bpy.props.IntProperty() bar = bpy.props.BoolProperty() if bar: # Do something with foo else: # Do something else :P I know how to set one attribute, like so: row.operator(\"my.button\", text=\"Button text\").foo=5 But what about multiple arguments? I tried several things that didn't worked, like (e.g.): With setattr(): row.operator(\"my.button\", text=\"Button text\").setattr(foo=5,bar=True) With a custom method setVal() in the operator class: row.operator(\"my.button\", text=\"Button text\").setVal(foo=5,bar=True) Maybe I must use a single EnumProperty? I hope to avoid this, so my question is: Is it possible to pass multiple custom arguments to set attributes in an operator class? And if yes, how ? Thanks for your help.", "Lines appear on the texture in render I am trying to learn Blender. While trying to render a subdivided plane with an image texture applied to it, the subdivision edges are not removed in the rendered result. Kindly, advise, why these edges appear in the render." ]